Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:11880

Mast4 microtubule associated serine/threonine kinase family member 4 ( MGI:1918885)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:11880 EMAGE:11880 EMAGE:11880 EMAGE:11880 EMAGE:11880
"Pseudo-wholemount" of euxassay_011099. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011099_01 euxassay_011099_02 euxassay_011099_03 euxassay_011099_04
EMAGE:11880 EMAGE:11880 EMAGE:11880 EMAGE:11880 EMAGE:11880
euxassay_011099_05 euxassay_011099_06 euxassay_011099_07 euxassay_011099_08 euxassay_011099_09
EMAGE:11880 EMAGE:11880 EMAGE:11880 EMAGE:11880 EMAGE:11880
euxassay_011099_10 euxassay_011099_11 euxassay_011099_12 euxassay_011099_13 euxassay_011099_14
EMAGE:11880 EMAGE:11880 EMAGE:11880 EMAGE:11880 EMAGE:11880
euxassay_011099_15 euxassay_011099_16 euxassay_011099_17 euxassay_011099_18 euxassay_011099_19
EMAGE:11880 EMAGE:11880 EMAGE:11880 EMAGE:11880
euxassay_011099_20 euxassay_011099_21 euxassay_011099_22 euxassay_011099_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:11880Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
11880_wholemount_strong.wlz
11880_wholemount_moderate.wlz
11880_wholemount_weak.wlz
11880_wholemount_possible.wlz
11880_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:11880_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
thymus primordium
strong strong
regionalstrong expression: see section 13 14 15 moderate expression: see section 11 12
hypothalamus mantle layer
strong strong
regionalstrong expression: see section 08 09 10 14 15
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 moderate expression: see section 06 18
telencephalon mantle layer
strong strong
regionalstrong expression: see section 09 17
olfactory cortex marginal layer
weak weak
regionalweak expression: see section 10 11 12 13 16 17 18
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 11 12 13 14 15 16 17
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 16 17 18 19
pons mantle layer
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
ventral grey horn
strong strong
regionalstrong expression: see section 17 moderate expression: see section 13 14 15 16 weak expression: see section 08 09 10 11 12 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37361
Entity Detected:Mast4, microtubule associated serine/threonine kinase family member 4 ( MGI:1918885)
Sequence:sense strand is shown

>T37361
AATGGTCCTTGTCTCTGGGTTATATGTCTGGTCTTCACCGGAGGGCACACAGGGACTATAAACACACTGC
AGGTCAGCTTTCTTTCTTTCTCTCCTTCCTTCCTTTCTAAGCTCTACCCTCAGGCCTTTATGCTGTGAGT
CCAAGAAGCACATATTCGTGGCAGGCACTGGACCAGCGCTGCTGGTGAGGAAACAGGCAAGTCCCTGGCT
GCACACAAATCCGCTAGCACTTAGGTGGAGCGATACGCATTAGGCATTGGAAGAGGCTTTAACTTTGCTT
TGGTTGAAGAAAAGGAGGGGGGTGGATTTTGGCATCATAGCATATATATTAAAGAATAATCAGGACATCA
GATACATTTTAATACATAGCTGGGGCCTTATGTTGTAGATGAAGCTTGCTGTTTTTAGCAAGTTCCTGGG
TTTCACATTCATTTCTGATGCATCGAGTAGCTCCATGCATTTCATAACACAATCTCTTTATTTGTATGCA
AAAAATTTACTGTATTAATAAAGAGCATCATTTTGTAACAAAGAGACTGGAGCTATTTGGTGCTTGAATG
TGAACATCCTTTTTACTTTTGCTAAGCCTTATTTAAATTTTGTATACCAGGAAATATGTAGAACTTGTCA
GATCATTTTAGCTCTGAGGGTTTTTCTGGGTTGTTTCTGTTGTTGCGATGGTTTTTTTATGTTTTGTTTT
GTTTTGTTTCGTTGGTGGGTTTGGGTTTTTGTTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 84356. Forward Primer - name:084356_F_cDNA_4930420O11Rik, sequence:AATGGTCCTTGTCTCTGGGTTA; Reverse Primer - name:084356_N_SP6_cDNA_4930420O11Rik, sequence:AAACAAAAACCCAAACCCACC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:11881 same embryo
 EurExpress:euxassay_011099 same experiment
 MGI:4826108 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS