Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12576

Plk1s1 polo-like kinase 1 substrate 1 ( MGI:2684960)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12576 EMAGE:12576 EMAGE:12576 EMAGE:12576 EMAGE:12576
"Pseudo-wholemount" of euxassay_013723. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013723_01 euxassay_013723_02 euxassay_013723_03 euxassay_013723_04
EMAGE:12576 EMAGE:12576 EMAGE:12576 EMAGE:12576 EMAGE:12576
euxassay_013723_05 euxassay_013723_06 euxassay_013723_07 euxassay_013723_08 euxassay_013723_09
EMAGE:12576 EMAGE:12576 EMAGE:12576 EMAGE:12576 EMAGE:12576
euxassay_013723_10 euxassay_013723_11 euxassay_013723_12 euxassay_013723_13 euxassay_013723_14
EMAGE:12576 EMAGE:12576 EMAGE:12576 EMAGE:12576 EMAGE:12576
euxassay_013723_15 euxassay_013723_16 euxassay_013723_17 euxassay_013723_18 euxassay_013723_19
EMAGE:12576 EMAGE:12576 EMAGE:12576 EMAGE:12576
euxassay_013723_20 euxassay_013723_21 euxassay_013723_22 euxassay_013723_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12576Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12576_wholemount_strong.wlz
12576_wholemount_moderate.wlz
12576_wholemount_weak.wlz
12576_wholemount_possible.wlz
12576_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12576_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thyroid gland
strong strong
regionalstrong expression: see section 12 16 17
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 09 10 11 14 15 moderate expression: see section 06 07 08 16 17 18 19
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 13 14
telencephalon mantle layer
strong strong
regionalstrong expression: see section 05 moderate expression: see section 06 09 10 11 12 13 14 15
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 13
midbrain mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 17 18 19 20 moderate expression: see section 10 11 12 14 15 16
midbrain marginal layer
moderate moderate
regionalmoderate expression: see section 10 11 12 14 15 16
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 08 09 10 16 17 18 moderate expression: see section 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37817
Entity Detected:Plk1s1, polo-like kinase 1 substrate 1 ( MGI:2684960)
Sequence:sense strand is shown

>T37817
TCAATCTCTGACCCACATTCACACCAACAGACAGCCCAGAGCAGCTGTGTGACAGACAGCTGTGTAGTGC
AGACTAATGGTGACACACAGTGCTTAAATAAGTCTGACAAAATACATGGAAAGACATCTCTTCAGACTGG
TGAGAAGGCGCCAGTCACAAGCTATGTATTGTCTGCAGAAGAACAAACTCATTGCTTGGAGATAGGAAGC
AGCACACAGCACAGCAAGAGTAATTTATCTGAAGGCAGAAAGTCTGCTGAACTCCATTCCTCGTTACAGG
AAAGATTAAGTCCAGAGAACAGCATCACTGATTTAAAGTGTGACAGTTCCAGCAGATCAGAGGGATCAGA
CAGAGAAATACTGACACAAGAACATATTGAAGTCAGGGAAGAAAGAGCCGGCCCGCTGGTCCCCATGATG
GCAGCTTCAGAACACTGTACATCTGCAAAGAAGTGGGCTGGAGAGAAGCATTCTGCTTGGGAAGCTTCCT
CAGATGATCTTGACCACGGGGACTCAAAGTCACAGAAGGCCGTCCTGAAACATGAGGAAGAGCAGGAGGA
GGGAAGCTCATGCAGCAGCAGCGACCTCACAGTTTCTGTCAGTGAAGATGATCTGATTCTAGAGAGTCTG
GCCGCACTGTCGAATCCAGGAGCCAAGAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 79768. Forward Primer - name:079768_F_cDNA_LOC228730, sequence:TCAATCTCTGACCCACATTCAC; Reverse Primer - name:079768_N_SP6_cDNA_LOC228730, sequence:ATCTTGGCTCCTGGATTCGAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12573 same embryo
 EMAGE:12575 same embryo
 EMAGE:12574 same embryo
 EurExpress:euxassay_013723 same experiment
 MGI:4827273 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS