Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12623

Kctd16 potassium channel tetramerisation domain containing 16 ( MGI:1914659)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12623 EMAGE:12623 EMAGE:12623 EMAGE:12623 EMAGE:12623
"Pseudo-wholemount" of euxassay_011293. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011293_01 euxassay_011293_02 euxassay_011293_03 euxassay_011293_04
EMAGE:12623 EMAGE:12623 EMAGE:12623 EMAGE:12623 EMAGE:12623
euxassay_011293_05 euxassay_011293_06 euxassay_011293_07 euxassay_011293_08 euxassay_011293_09
EMAGE:12623 EMAGE:12623 EMAGE:12623 EMAGE:12623 EMAGE:12623
euxassay_011293_10 euxassay_011293_11 euxassay_011293_12 euxassay_011293_13 euxassay_011293_14
EMAGE:12623 EMAGE:12623 EMAGE:12623 EMAGE:12623 EMAGE:12623
euxassay_011293_15 euxassay_011293_16 euxassay_011293_17 euxassay_011293_18 euxassay_011293_19
EMAGE:12623 EMAGE:12623 EMAGE:12623 EMAGE:12623
euxassay_011293_20 euxassay_011293_21 euxassay_011293_22 euxassay_011293_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12623Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12623_wholemount_strong.wlz
12623_wholemount_moderate.wlz
12623_wholemount_weak.wlz
12623_wholemount_possible.wlz
12623_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12623_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
hand
weak weak
regionalweak expression: see section 01 02 03 04 05
foot
weak weak
regionalweak expression: see section 02 03 05 21 22 23
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 12 15 16 17 18 weak expression: see section 07 08 09 10 11 13 14 19 20
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 09 17 moderate expression: see section 07 10 11 12 14 18 19 weak expression: see section 08 15 16
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 weak expression: see section 08 16 17 18 19 20 21 22
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 09 10 11 12 14 19 weak expression: see section 08 15 16 17 18
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 09 12 15 16 17 18 19 weak expression: see section 07 08 10 11 20
facial vii ganglion
strong strong
regionalstrong expression: see section 04 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 18 moderate expression: see section 08 09 19 20
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 18 19 20 21 22 23
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07 18 moderate expression: see section 08 09 19 20
ventral grey horn
moderate moderate
single cellmoderate expression: see section 13 14 15 17 18 weak expression: see section 11 12 16
dorsal root ganglion
strong strong
regionalstrong expression: see section 11 12 13 17 18 19 moderate expression: see section 09 10 weak expression: see section 08
neural retina
strong strong
regionalstrong expression: see section 01 02 03 weak expression: see section 04 23
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 11 12 15 16 17 18
vomeronasal organ
weak weak
regionalweak expression: see section 15
trachea
strong strong
regionalstrong expression: see section 14 moderate expression: see section 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37765
Entity Detected:Kctd16, potassium channel tetramerisation domain containing 16 ( MGI:1914659)
Sequence:sense strand is shown

>T37765
AATAAGCATCCCCCATTCTCTCCTGTGGAAAATGTTCTCCCCAAAGAGAGACACTGCTAACGATCTAGCC
AAGGACTCCAAGGGAAGGTTTTTCATTGACAGAGATGGCTTTCTGTTCCGTTATATTCTGGACTATCTCA
GGGACAGGCAGGTGGTCCTGCCTGATCACTTTCCAGAAAGAGGAAGGCTGAAAAGAGAAGCTGAGTACTT
CCAGCTCCCTGACCTCGTCAAACTCCTGGCCCCCGAGGATGTCAAGCAAAGCCCGGATGAGTTCTGCCAC
AGTGACTTCGAAGATGCCTCCCAAGGAAGCGACACGAGAATCTGCCCCCCCTCTTCGCTGCTTCCTCACG
ACCGCAAGTGGGGTTTTATTACTGTGGGTTACAGGGGATCCTGTACCTTGGGCAGAGAGGGGCAAGCAGA
TGCCAAGTTCCGGAGAGTCCCCCGGATTTTGGTTTGCGGAAGAATTTCCTTGGCAAAAGAAGTCTTTGGA
GAAACTTTGAATGAAAGTAGAGACCCCGACCGAGCTCCAGAAAGATACACCTCCAGATTTTATCTCAAGT
TTAAACATCTGGAAAGAGCTTTTGATATGTTGTCAGAGTGTGGATTCCA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 85921. Forward Primer - name:085921_F_cDNA_Kctd16, sequence:AATAAGCATCCCCCATTCTCTC; Reverse Primer - name:085921_N_SP6_cDNA_Kctd16, sequence:TGGAATCCACACTCTGACAAC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12624 same embryo
 EMAGE:12621 same embryo
 EMAGE:12620 same embryo
 EMAGE:12622 same embryo
 EMAGE:12619 same embryo
 EurExpress:euxassay_011293 same experiment
 MGI:4825737 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS