Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12630

Slc10a3 solute carrier family 10 (sodium/bile acid cotransporter family), member 3 ( MGI:95048)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12630 EMAGE:12630 EMAGE:12630 EMAGE:12630 EMAGE:12630
"Pseudo-wholemount" of euxassay_011399. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011399_01 euxassay_011399_02 euxassay_011399_03 euxassay_011399_04
EMAGE:12630 EMAGE:12630 EMAGE:12630 EMAGE:12630 EMAGE:12630
euxassay_011399_05 euxassay_011399_06 euxassay_011399_07 euxassay_011399_08 euxassay_011399_09
EMAGE:12630 EMAGE:12630 EMAGE:12630 EMAGE:12630 EMAGE:12630
euxassay_011399_10 euxassay_011399_11 euxassay_011399_12 euxassay_011399_13 euxassay_011399_14
EMAGE:12630 EMAGE:12630 EMAGE:12630 EMAGE:12630 EMAGE:12630
euxassay_011399_15 euxassay_011399_16 euxassay_011399_17 euxassay_011399_18 euxassay_011399_19
EMAGE:12630 EMAGE:12630 EMAGE:12630 EMAGE:12630 EMAGE:12630
euxassay_011399_20 euxassay_011399_21 euxassay_011399_22 euxassay_011399_23 euxassay_011399_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12630Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12630_wholemount_strong.wlz
12630_wholemount_moderate.wlz
12630_wholemount_weak.wlz
12630_wholemount_possible.wlz
12630_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12630_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
left lung
strong strong
spottedstrong expression: see section 05 06 07 08 09 10 11 12
right lung
strong strong
spottedstrong expression: see section 14 15 16 17 18 19 20 21 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1756
Entity Detected:Slc10a3, solute carrier family 10 (sodium/bile acid cotransporter family), member 3 ( MGI:95048)
Sequence:sense strand is shown

>T1756
TGGCCTCGAGGCCAGAATTCGGACGAGGAGTTCTCTGAACTACTGTTACAGGTCATCAAGCCCTTCAGCT
TTATACTTCTCCTGGGTGGCCTGTTCCTGGCCTACCACATGGGGGTCTTCATCCTAGTGGGAGTCAGGTT
ACCCATTGTACTGGTGGGTTTCACAGTGCCTCTTGTTGGCCTCTTGGTGGGCTACAGCCTGGCCATCTGC
CTGAAGCTGCCAGTGGCTCAGCGACGA
Notes:The probe template was PCR amplified from IMAGE:483262 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:483262 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12626 same embryo
 EMAGE:12629 same embryo
 EMAGE:12625 same embryo
 EMAGE:12627 same embryo
 EMAGE:12628 same embryo
 EurExpress:euxassay_011399 same experiment
 MGI:4828090 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS