Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:12909

Atp1b2 ATPase, Na+/K+ transporting, beta 2 polypeptide ( MGI:88109)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:12909 EMAGE:12909 EMAGE:12909 EMAGE:12909 EMAGE:12909
"Pseudo-wholemount" of euxassay_011653. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011653_01 euxassay_011653_02 euxassay_011653_03 euxassay_011653_04
EMAGE:12909 EMAGE:12909 EMAGE:12909 EMAGE:12909 EMAGE:12909
euxassay_011653_05 euxassay_011653_06 euxassay_011653_07 euxassay_011653_08 euxassay_011653_09
EMAGE:12909 EMAGE:12909 EMAGE:12909 EMAGE:12909 EMAGE:12909
euxassay_011653_10 euxassay_011653_11 euxassay_011653_12 euxassay_011653_13 euxassay_011653_14
EMAGE:12909 EMAGE:12909 EMAGE:12909 EMAGE:12909 EMAGE:12909
euxassay_011653_15 euxassay_011653_16 euxassay_011653_17 euxassay_011653_18 euxassay_011653_19
EMAGE:12909 EMAGE:12909 EMAGE:12909 EMAGE:12909
euxassay_011653_20 euxassay_011653_21 euxassay_011653_22 euxassay_011653_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:12909Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
12909_wholemount_strong.wlz
12909_wholemount_moderate.wlz
12909_wholemount_weak.wlz
12909_wholemount_possible.wlz
12909_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:12909_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
pituitary gland
weak weak
regionalweak expression: see section 11 12 13 14 15 16
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 11 12 13 14
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16
pons ventricular layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 moderate expression: see section 05
midbrain ventricular layer
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16
ventral grey horn
strong strong
single cellstrong expression: see section 11 12 13 15 16
spinal cord ventricular layer
strong strong
single cellstrong expression: see section 12 13 14
liver lobe
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31957
Entity Detected:Atp1b2, ATPase, Na+/K+ transporting, beta 2 polypeptide ( MGI:88109)
Sequence:sense strand is shown

>T31957
CAACTGGGCGATTGCTCTGGCATTGGGGACCCTACCCACTATGGTTACAGCACCGGGCAGCCCTGTGTCT
TCATCAAAATGAATCGGGTCATCAACTTCTATGCAGGGGCAAACCAGAGCATGAATGTCACTTGTGTTGG
CAAGAGAGATGAAGATGCTGAGAACCTTGGCCACTTTGTCATGTTCCCTGCTAATGGCAGCATTGATCTG
ATGTACTTTCCCTACTATGGCAAAAAGTTCCATGTAAACTATACTCAGCCTTTGGTGGCTGTAAAGTTCC
TGAATGTGACCCCCAACGTGGAGGTGAATGTTGAATGCCGCATCAACGCTGCCAATATTGCCACAGACGA
TGAGCGGGACAAGTTCGCTGGCCGTGTGGCCTTCAAACTCCGGATCAACAAAACCTGAGGCTCCCCACCC
CCACCCGCCCACACTCTCCTGTGGATGCTTCTGGAATGTCCTTGACCCTGCCTGATCCCTCCCTCACCCA
CCCCAAAGGTATTTTTTATAATAGAGCTATGACTTGTCTGAGCCTCACACCCTTTCCTCAACTTCTCTAC
CTAGCCTGATGCCCACACAATTTCCAACATCTTCCAACCTTAGCTTAGCCAGAGACAGAGAGGAGTCGGG
AGTTTTCTAGTTCGGGAACCGGAGTTGTCACTCAGCGACAGAGGACTTGCCTAGCAAGCACGAGGGCCTC
AGCATTGTTGGAGGTTTTCTAGTTTGAGTTTATGAATGAGATGCCCTTACAGCTCCTGTTTCAGTTTCTA
CTCCCATCCCCTTAGAGGTACAGGAAATGGTCTCATCCACCCAGCCTCTACCCCACAGATCCCTCGAACC
CGTTTCAGCCACTTGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6490870), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 59360. Forward Primer - name:059360_F_IRAV100_a11_Atp1b2, sequence:CAACTGGGCGATTGCTCT; Reverse Primer - name:059360_R_SP6_IRAV100_a11_Atp1b2, sequence:AGCAAGTGGCTGAAACGG. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:12911 same embryo
 EMAGE:12912 same embryo
 EMAGE:12908 same embryo
 EMAGE:12910 same embryo
 EMAGE:12907 same embryo
 EurExpress:euxassay_011653 same experiment
 MGI:4823307 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS