Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13000

Akd1 adenylate kinase domain containing 1 ( MGI:2685080)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13000 EMAGE:13000 EMAGE:13000 EMAGE:13000 EMAGE:13000
"Pseudo-wholemount" of euxassay_013726. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013726_01 euxassay_013726_02 euxassay_013726_03 euxassay_013726_04
EMAGE:13000 EMAGE:13000 EMAGE:13000 EMAGE:13000 EMAGE:13000
euxassay_013726_05 euxassay_013726_06 euxassay_013726_07 euxassay_013726_08 euxassay_013726_09
EMAGE:13000 EMAGE:13000 EMAGE:13000 EMAGE:13000 EMAGE:13000
euxassay_013726_10 euxassay_013726_11 euxassay_013726_12 euxassay_013726_13 euxassay_013726_14
EMAGE:13000 EMAGE:13000 EMAGE:13000 EMAGE:13000 EMAGE:13000
euxassay_013726_15 euxassay_013726_16 euxassay_013726_17 euxassay_013726_18 euxassay_013726_19
EMAGE:13000 EMAGE:13000 EMAGE:13000 EMAGE:13000
euxassay_013726_20 euxassay_013726_21 euxassay_013726_22 euxassay_013726_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13000Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13000_wholemount_strong.wlz
13000_wholemount_moderate.wlz
13000_wholemount_weak.wlz
13000_wholemount_possible.wlz
13000_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13000_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
medulla oblongata part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 weak expression: see section 23
diencephalon roof plate
moderate moderate
regionalmoderate expression: see section 11 12 13
choroid invagination
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 14 15 16 17 18 19
metencephalon part of 4th ventricle choroid plexus
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 weak expression: see section 23
left lung
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15
right lung
strong strong
regionalstrong expression: see section 16 17 18 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37803
Entity Detected:Akd1, adenylate kinase domain containing 1 ( MGI:2685080)
Sequence:sense strand is shown

>T37803
CAGAAATCATTGAGAGTCGCAGGAGAAAGAAGAGGGACTTCCCCAAGGAAGGGAAGTCTGAAGAGGAAGA
AGAGGAAGAAGAACAAGAAGAGGAGGAGGCATTCATAGCTGAAATGCAGATGGTGGCTGAGATTCTCCAA
CACCTCGTCCAGAGGCCCGAGGATTATTTGGAGAACGTTGAAATCACTGTGAAGCTTTATAAGGAGCTAC
TGCTCAGTGCTTTAGAGGAGGTAATGGCTGAGCACAATCCCCAGTATCTCATCGAGCTAGATGGGAACAA
GTCTCCAGAAGAGCTCTTCATGACAGTCATAGAGCGGCTGAAGTACTTGAACGTGAGACGAGCAGCTGTC
ATAACCAAGCTTCAGGGTACAGAAGAGGAAATGACTGACATAATAGATACTGAAGAGCTCTTCCGTACAG
TGTCGTCGTATAAACTCATTGCGCCAAGGTATAGATGGTACCGAAGCAAGTGGGCACGTTCTTGTCCGGT
GTCCTTAAAGGATGGGAACATTTATTCAGGAGCAGCAGACTATACTGTGAGTTTTCTAGGTAAAATGTAC
TGCCTTTCTTCTGAAGAAACGCTAAAGTTGTTCTCACTGAACCCCCGCCCCTTCCTCCTACCACCTATGC
CTTTGCCACCATGCAAAGTCTTTAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 82576. Forward Primer - name:082576_F_cDNA_LOC215946, sequence:CAGAAATCATTGAGAGTCGCAG; Reverse Primer - name:082576_N_SP6_cDNA_LOC215946, sequence:ATAAAGACTTTGCATGGTGGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13003 same embryo
 EMAGE:13002 same embryo
 EMAGE:13001 same embryo
 EurExpress:euxassay_013726 same experiment
 MGI:4823064 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS