Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13022

Man1a mannosidase 1, alpha ( MGI:104677)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13022 EMAGE:13022 EMAGE:13022 EMAGE:13022 EMAGE:13022
"Pseudo-wholemount" of euxassay_013658. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013658_01 euxassay_013658_02 euxassay_013658_03 euxassay_013658_04
EMAGE:13022 EMAGE:13022 EMAGE:13022 EMAGE:13022 EMAGE:13022
euxassay_013658_05 euxassay_013658_06 euxassay_013658_07 euxassay_013658_08 euxassay_013658_09
EMAGE:13022 EMAGE:13022 EMAGE:13022 EMAGE:13022 EMAGE:13022
euxassay_013658_10 euxassay_013658_11 euxassay_013658_12 euxassay_013658_13 euxassay_013658_14
EMAGE:13022 EMAGE:13022 EMAGE:13022 EMAGE:13022 EMAGE:13022
euxassay_013658_15 euxassay_013658_16 euxassay_013658_17 euxassay_013658_18 euxassay_013658_19
EMAGE:13022 EMAGE:13022 EMAGE:13022 EMAGE:13022
euxassay_013658_20 euxassay_013658_21 euxassay_013658_22 euxassay_013658_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13022Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13022_wholemount_strong.wlz
13022_wholemount_moderate.wlz
13022_wholemount_weak.wlz
13022_wholemount_possible.wlz
13022_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13022_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
humerus
moderate moderate
regionalmoderate expression: see section 05 06 22
hindlimb digit 1 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 22
hindlimb digit 2 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 21 22
hindlimb digit 3 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 20 21 22
hindlimb digit 4 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 20 21
hindlimb digit 5 mesenchyme
moderate moderate
regionalmoderate expression: see section 07 20 21
lower leg rest of mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03
femur
strong strong
regionalstrong expression: see section 10 19 moderate expression: see section 20
upper leg rest of mesenchyme
weak weak
regionalweak expression: see section 04
vibrissa
moderate moderate
regionalmoderate expression: see section 08 09 23 weak expression: see section 10 11 21 22
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
telencephalon mantle layer
weak weak
regionalweak expression: see section 03 04 05 12 13 14 15
medulla oblongata alar plate mantle layer
weak weak
regionalweak expression: see section 11
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 06 08 09 10 13 14 15 16 17
pons mantle layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 13 14 15 16 17
midbrain mantle layer
weak weak
regionalweak expression: see section 05 06 07 08 09 10 14 15 16
dorsal grey horn
weak weak
regionalweak expression: see section 11 16
ventral grey horn
moderate moderate
regionalmoderate expression: see section 16 weak expression: see section 10 11 12 13
pharyngo-tympanic tube
weak weak
regionalweak expression: see section 01 02 03 04 23
extrinsic ocular muscle
moderate moderate
regionalmoderate expression: see section 21 weak expression: see section 07 08 22
lower lip
weak weak
regionalweak expression: see section 07 16 23
upper lip
weak weak
regionalweak expression: see section 14 15 16 18
palatal shelf
weak weak
regionalweak expression: see section 13 15
bladder
weak weak
regionalweak expression: see section 13 14 15
urethra of male
weak weak
regionalweak expression: see section 13 15
axial skeleton cervical region
moderate moderate
regionalmoderate expression: see section 09 10 11 12 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31993
Entity Detected:Man1a, mannosidase 1, alpha ( MGI:104677)
Sequence:sense strand is shown

>T31993
AAGGAAAAGGTGGCCCAGGACCAGCTGCGTGACAAGGATCTGTTTAGGGGCTTGCCCAAGGTGGACTTCC
TGCCCCCCGTCGGGGTAGAGAACCGGGAGCCCGCTGACGCCACCATCCGTGAGAAGAGGGCAAAGATCAA
AGAGATGATGACCCATGCTTGGAATAATTATAAACGCTATGCGTGGGGCTTGAACGAACTGAAACCTATA
TCAAAAGAAGGCCATTCAAGCAGTTTGTTTGGCAACATCAAAGGAGCTACAATAGTAGATGCCCTGGATA
CCCTTTTCATTATGGGCATGAAGACTGAATTTCAAGAAGCTAAATCGTGGATTAAAAAATATTTAGATTT
TAATGTGAATGCTGAAGTTTCTGTTTTTGAAGTCAACATACGCTTCGTCGGTGGACTGCTGTCAGCCTAC
TATTTGTCCGGAGAGGAGATATTTCGAAAGAAAGCAGTGGAACTTGGGGTAAAATTGCTACCTGCATTTC
ATACTCCCTCTGGAATACCTTGGGCATTGCTGAATATGAAAAGTGGGATCGGGCGGAACTGGCCCTGGGC
CTCTGGAGGCAGCAGTATCCTGGCCGAATTTGGAACTCTGCATTTAGAGTTTATGCACTTGTCCCACTTA
TCAGGAGACCCAGTCTTTGCCGAAAAGGTTATGAAAATTCGAACAGTGTTGAACAAACTGGACAAACCAG
AAGGCCTTTATCCTAACTATCTGAACCCCAGTAGTGGACAGTGGGGTCAACATCATGTGTCGGTTGGAGG
ACTTGGAGACAGCTTTTATGAATATTTGCTTAAGGCGTGGTTAATGTCTGACAAGACAGATCTCGAAGCC
AAGAAGATGTATTTTGATGCTGTTCAGGCCATCGAGACTCACTTGATCCGCAAGTCAAGTGGGGGACTAA
CGTACATCGCAGAGTGGAAGGGGGGCCTCCTGGAACACAAGATGGGCCACCTGACGTGCTTTGCAGGAGG
CA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:4223319), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 17735. Forward Primer - name:017735_F_IRAV28-31_N07_Man1a, sequence:AAGGAAAAGGTGGCCCAG; Reverse Primer - name:017735_R_SP6_IRAV28-31_N07_Man1a, sequence:ATGCCTCCTGCAAAGCAC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13019 same embryo
 EMAGE:13023 same embryo
 EMAGE:13020 same embryo
 EMAGE:13018 same embryo
 EMAGE:13021 same embryo
 EurExpress:euxassay_013658 same experiment
 MGI:4826072 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS