Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13750

Mir186 microRNA 186 ( MGI:2676850)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13750 EMAGE:13750 EMAGE:13750 EMAGE:13750 EMAGE:13750
"Pseudo-wholemount" of euxassay_019223. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019223_01 euxassay_019223_02 euxassay_019223_03 euxassay_019223_04
EMAGE:13750 EMAGE:13750 EMAGE:13750 EMAGE:13750 EMAGE:13750
euxassay_019223_05 euxassay_019223_06 euxassay_019223_07 euxassay_019223_08 euxassay_019223_09
EMAGE:13750 EMAGE:13750 EMAGE:13750 EMAGE:13750 EMAGE:13750
euxassay_019223_10 euxassay_019223_11 euxassay_019223_12 euxassay_019223_13 euxassay_019223_14
EMAGE:13750 EMAGE:13750 EMAGE:13750 EMAGE:13750 EMAGE:13750
euxassay_019223_15 euxassay_019223_16 euxassay_019223_17 euxassay_019223_18 euxassay_019223_19
EMAGE:13750 EMAGE:13750 EMAGE:13750 EMAGE:13750 EMAGE:13750
euxassay_019223_20 euxassay_019223_21 euxassay_019223_22 euxassay_019223_23 euxassay_019223_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13750Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13750_wholemount_strong.wlz
13750_wholemount_moderate.wlz
13750_wholemount_weak.wlz
13750_wholemount_possible.wlz
13750_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13750_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T70297
Entity Detected:Mir186, microRNA 186 ( MGI:2676850)
Sequence:sense strand is shown

>T70297
CAAAGAATTCTCCTTTTGGGCT
Notes:The probe used by the EURExpress consortium to detect the presence of miRNA mmu-miR-186 was custom designed and ordered from Sigma-Exiqon by the EURExpress partner in Geneva and then distributed to the ISH generating units within the consortium.
Chemistry:LNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:13749 same embryo
 EMAGE:13746 same embryo
 EMAGE:13747 same embryo
 EMAGE:13745 same embryo
 EMAGE:13748 same embryo
 EurExpress:euxassay_019223 same experiment
 MGI:4826228 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS