Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:13766

Sox4 SRY-box containing gene 4 ( MGI:98366)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:13766 EMAGE:13766 EMAGE:13766 EMAGE:13766 EMAGE:13766
"Pseudo-wholemount" of euxassay_019583. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_019583_01 euxassay_019583_02 euxassay_019583_03 euxassay_019583_04
EMAGE:13766 EMAGE:13766 EMAGE:13766 EMAGE:13766 EMAGE:13766
euxassay_019583_05 euxassay_019583_06 euxassay_019583_07 euxassay_019583_08 euxassay_019583_09
EMAGE:13766 EMAGE:13766 EMAGE:13766 EMAGE:13766 EMAGE:13766
euxassay_019583_10 euxassay_019583_11 euxassay_019583_12 euxassay_019583_13 euxassay_019583_14
EMAGE:13766 EMAGE:13766 EMAGE:13766 EMAGE:13766 EMAGE:13766
euxassay_019583_15 euxassay_019583_16 euxassay_019583_17 euxassay_019583_18 euxassay_019583_19
EMAGE:13766 EMAGE:13766 EMAGE:13766
euxassay_019583_20 euxassay_019583_21 euxassay_019583_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:13766Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
13766_wholemount_strong.wlz
13766_wholemount_moderate.wlz
13766_wholemount_weak.wlz
13766_wholemount_possible.wlz
13766_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:13766_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 04 21 22
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 04 05 20 21
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 04 05 06 07 20 21
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 05 06 07 20 21
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 05 06 07 19 20
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 16 17 18 19
vibrissa
strong strong
regionalstrong expression: see section 04 05 06 17 18 19 20 21
hypothalamus mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 12 13 14 15 16
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 15 16
dorsal grey horn
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 weak expression: see section 10
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 10 16 17
cervical ganglion
strong strong
regionalstrong expression: see section 08 16 17
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 09 10 11 12 16 17 18
neural retina
strong strong
regionalstrong expression: see section 01 02 03 21 22
heart valve
moderate moderate
regionalmoderate expression: see section 11 12 13 14
esophagus
strong strong
regionalstrong expression: see section 13
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 11 14 weak expression: see section 15
lower jaw molar
moderate moderate
regionalmoderate expression: see section 05 06 17 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 09 10 14 weak expression: see section 15
upper jaw molar
moderate moderate
regionalmoderate expression: see section 05 06 17 18
metanephros
moderate moderate
regionalmoderate expression: see section 19 20 21 weak expression: see section 07 08 09 10 11 17 18
testis
moderate moderate
regionalmoderate expression: see section 05 weak expression: see section 06 07 08 20 21 22
lung
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 21 22 moderate expression: see section 04 14 15 16 17 18 19 20
trachea
strong strong
regionalstrong expression: see section 13 14
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 11 15 16 weak expression: see section 12 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T55187
Entity Detected:Sox4, SRY-box containing gene 4 ( MGI:98366)
Sequence:sense strand is shown

>T55187
CAAGAGGCAGGAGAGGAGAGAGGGAAAAAAGAAAACAAAAAACAAACAAACAAAAAAACAAACAAAAAAA
TGTTAAAAAGAAGAAGAAAGAAAGAAACAGAAAAAAAATGAGTTAAAAAGAATAGATGGAGAGTAGAAGG
AGAAAGGGGAAAAGAAAAGGAAGAAAAAGTGCATAGAGCTGGCCTGGAACACGTCCCGCCGTTGGAGAAG
GAGCGCGGGGGCGTTAGTGGACCCGCGCTCCCATCCCCCACTCTCAGGGCTGGGGACTCGAAGGAGGCGG
AGAGTAGACGGGGGCGACCTTTTTTTGTTGTTGTTATTGATGTTGGTGGTGGCTAAAAAAGCTACTTCGA
GTTTCCTCCCCAATTTTGCTTGAAGAGACTCCCCCCCACCCCACCCTTCCAACGAGCTTCCGGACTTGGT
TGCACCCCCAGCAAGAAAAGAAGCCAAGCAAAGCTTCTAAAGACCGAAGGAATCTTTCCCTCACCCCCAC
CCCCTCGCCTTGGTGATTTCTTGTTTGATTTTGCCTCATGGTCAAGAAAGGAGGGGGAAAATCCAGCGTG
CCCCATCTCCTACCCACCCCCTCTTTGTATTCTCTTTGTATTTTTCCCCTTCTTAAAATTTCTTTTTCTG
CAATGAAGACAGAAAGAAGGCTCTGGGGTGATGCGTTTGGCATTTGTGTTGAGCTTAGGGGAGCATTGGC
ATGGAGAAACTCCACGCTGGCGAAGTCCCGGGCTGGGCTTTCTCCTCCTCCCCCCACCTTTTTTCCCCTT
GTCCTTGCAGCTGGAGATGTGCTGGGAGTA
Notes:The probe template was PCR amplified from E14.5 mouse embryo cDNA using gene specific primers. Forward Primer - name:unspecified, sequence:CAAGAGGCAGGAGAGGAGAG; Reverse Primer - name:unspecified, sequence:TACTCCCAGCACATCTCCAG. The reverse primer contains a 5' extension containing an unspecified RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using unspecified polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4828392 same experiment
 EurExpress:euxassay_019583 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS