Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14735

Klf15 Kruppel-like factor 15 ( MGI:1929988)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14735 EMAGE:14735 EMAGE:14735 EMAGE:14735 EMAGE:14735
"Pseudo-wholemount" of euxassay_005688. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_005688_01 euxassay_005688_02 euxassay_005688_03 euxassay_005688_04
EMAGE:14735 EMAGE:14735 EMAGE:14735 EMAGE:14735 EMAGE:14735
euxassay_005688_05 euxassay_005688_06 euxassay_005688_07 euxassay_005688_08 euxassay_005688_09
EMAGE:14735 EMAGE:14735 EMAGE:14735 EMAGE:14735 EMAGE:14735
euxassay_005688_10 euxassay_005688_11 euxassay_005688_12 euxassay_005688_13 euxassay_005688_14
EMAGE:14735 EMAGE:14735 EMAGE:14735 EMAGE:14735 EMAGE:14735
euxassay_005688_15 euxassay_005688_16 euxassay_005688_17 euxassay_005688_18 euxassay_005688_19
EMAGE:14735 EMAGE:14735 EMAGE:14735
euxassay_005688_20 euxassay_005688_21 euxassay_005688_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14735Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14735_wholemount_strong.wlz
14735_wholemount_moderate.wlz
14735_wholemount_weak.wlz
14735_wholemount_possible.wlz
14735_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14735_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11
naris
moderate moderate
regionalmoderate expression: see section 11 12 14 15 16
nasal septum
moderate moderate
regionalmoderate expression: see section 13
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 15 16 17 18 19 20 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2759
Entity Detected:Klf15, Kruppel-like factor 15 ( MGI:1929988)
Sequence:sense strand is shown

>T2759
TTCGGACGAGGCCAAGAGCAGCCACCTCAAGGCCCACCTGCGTCGGCACACAGGCGAGAAGCCCTTTGCC
TGCACCTGGCCAGGCTGCGGCTGGAGGTTTTCCCGCTCAGATGAGTTGTCAAGGCACCGGCGATCTCACT
CGGGTGTGAAGCCGTACCAGTGTCCCGTGTGCGAGAAGAAATTCGCGCGGAGTGACCACCTCTCCAAACA
CATCAAAGTGCATCGCTTCCCACGAAGCAGCCGCGCAGTACGCGCCATCAACTGAGCGCAGTGGCCGCCC
TTCCCTCCCCCAGCTCCACGTTTTGTTTTTAAATGCAATAACTTATTGCCTCTTTTCAGAAGGATGTGAC
AATATTACCAGCCCCCTCCCCCTTCTGAATCTTAGGAGGTATGACCCAGAGCCACCATGGCTGCCTTTCT
GGGGAAGACCTAGAGTCCCTATGGTCCCTGGGGGCTGGTTCCCCGGTGGCCCAGGTGGCCCAGGCAGGCC
TGTGCCCTTGTGCCTTTGTGCCTTCCTGCCAGCTGGAAGCAGTGTTTGGGGGGCCCTTGCCCTCTTCCCA
CTGGGCTC
Notes:The probe template was PCR amplified from IMAGE:1514543 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1514543 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14733 same embryo
 EMAGE:14732 same embryo
 EMAGE:14734 same embryo
 EurExpress:euxassay_005688 same experiment
 MGI:4825781 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS