Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:14969

Bin1 bridging integrator 1 ( MGI:108092)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:14969 EMAGE:14969 EMAGE:14969 EMAGE:14969 EMAGE:14969
"Pseudo-wholemount" of euxassay_008004. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008004_01 euxassay_008004_02 euxassay_008004_03 euxassay_008004_04
EMAGE:14969 EMAGE:14969 EMAGE:14969 EMAGE:14969 EMAGE:14969
euxassay_008004_05 euxassay_008004_06 euxassay_008004_07 euxassay_008004_08 euxassay_008004_09
EMAGE:14969 EMAGE:14969 EMAGE:14969 EMAGE:14969 EMAGE:14969
euxassay_008004_10 euxassay_008004_11 euxassay_008004_12 euxassay_008004_13 euxassay_008004_14
EMAGE:14969 EMAGE:14969 EMAGE:14969 EMAGE:14969 EMAGE:14969
euxassay_008004_15 euxassay_008004_16 euxassay_008004_17 euxassay_008004_18 euxassay_008004_19
EMAGE:14969 EMAGE:14969 EMAGE:14969
euxassay_008004_20 euxassay_008004_21 euxassay_008004_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:14969Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
14969_wholemount_strong.wlz
14969_wholemount_moderate.wlz
14969_wholemount_weak.wlz
14969_wholemount_possible.wlz
14969_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:14969_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
upper arm muscle
strong strong
regionalstrong expression: see section 01 02 03 18 19 21 22
upper leg muscle
strong strong
regionalstrong expression: see section 01 02 03 04 18 19 20 21
diaphragm
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 14 15 16 17 18 19 20 21
forearm rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 22
shoulder joint primordium
strong strong
regionalstrong expression: see section 22
shoulder rest of mesenchyme
strong strong
regionalstrong expression: see section 01 02 21
hand mesenchyme
strong strong
regionalstrong expression: see section 22 moderate expression: see section 01 02 03 18 19 20 21
foot mesenchyme
moderate moderate
regionalmoderate expression: see section 02 03 17 18 21
vertebral axis musculature
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
not examined not examined
regionalnot examined expression: see section 14
tongue muscle
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14
tail mesenchyme
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36049
Entity Detected:Bin1, bridging integrator 1 ( MGI:108092)
Sequence:sense strand is shown

>T36049
TACCTAGGCCAGTTCCCTGATATCAAGTCGCGCATTGCCAAGCGGGGGCGGAAGCTGGTGGACTATGACA
GTGCCCGGCACCACTATGAGTCTCTTCAAACCGCCAAAAAGAAGGATGAAGCCAAAATTGCCAAGCCTGT
CTCGCTGCTTGAGAAAGCCGCCCCCCAGTGGTGCCAAGGCAAACTACAGGCTCATCTTGTAGCTCAAACT
AACCTGCTCCGAAATCAGGCAGAAGAGGAGCTCATCAAAGCCCAGAAGGTGTTCGAGGAGATGAACGTGG
ATCTGCAGGAGGAGCTGCCATCCCTGTGGAACAGCCGTGTAGGTTTCTATGTCAACACGTTCCAGAGCAT
CGCGGGTCTGGAGGAAAACTTCCATAAAGAGATGAGTAAGCTCAATCAGAACCTCAATGATGTCCTGGTC
AGCCTAGAGAAGCAGCACGGGAGCAACACCTTCACAGTCAAGGCCCAACCCAGTGACAATGCCCCTGAGA
AAGGGAACAAGAGCCCGTCACCTCCTCCAGATGGCTCCCCTGCTGCTACCCCTGAGATCAGAGTGAACCA
TGAGCCAGAGCCGGCCAGTGGGGCCTCACCCGGGGCTACCATCCCCAAGTCCCCATCTCAGCTCCGGAAA
GGCCCACCTGTCCCTCCGCCTCCCAAACACACCCCATCCAAGGAGATGAAGCAGGAGCAGATTCTCAGCC
TTTTTGATGACGCATTTGTCCCTGAGATCAGCGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 98909. Forward Primer - name:098909_F_cDNA_Bin1, sequence:TACCTAGGCCAGTTCCCTGATA; Reverse Primer - name:098909_N_SP6_cDNA_Bin1, sequence:ACGCTGATCTCAGGGACAAAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:14970 same embryo
 EMAGE:14971 same embryo
 EMAGE:14968 same embryo
 EurExpress:euxassay_008004 same experiment
 MGI:4823475 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS