Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:15805

Alms1 Alstrom syndrome 1 homolog (human) ( MGI:1934606)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:15805 EMAGE:15805 EMAGE:15805 EMAGE:15805 EMAGE:15805
"Pseudo-wholemount" of euxassay_013199. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013199_01 euxassay_013199_02 euxassay_013199_03 euxassay_013199_04
EMAGE:15805 EMAGE:15805 EMAGE:15805 EMAGE:15805 EMAGE:15805
euxassay_013199_05 euxassay_013199_06 euxassay_013199_07 euxassay_013199_08 euxassay_013199_09
EMAGE:15805 EMAGE:15805 EMAGE:15805 EMAGE:15805 EMAGE:15805
euxassay_013199_10 euxassay_013199_11 euxassay_013199_12 euxassay_013199_13 euxassay_013199_14
EMAGE:15805 EMAGE:15805 EMAGE:15805 EMAGE:15805 EMAGE:15805
euxassay_013199_15 euxassay_013199_16 euxassay_013199_17 euxassay_013199_18 euxassay_013199_19
EMAGE:15805 EMAGE:15805 EMAGE:15805 EMAGE:15805
euxassay_013199_20 euxassay_013199_21 euxassay_013199_22 euxassay_013199_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:15805Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
15805_wholemount_strong.wlz
15805_wholemount_moderate.wlz
15805_wholemount_weak.wlz
15805_wholemount_possible.wlz
15805_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:15805_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19 20
pharynx epithelium
strong strong
regionalstrong expression: see section 12 13 14 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38914
Entity Detected:Alms1, Alstrom syndrome 1 homolog (human) ( MGI:1934606)
Sequence:sense strand is shown

>T38914
GACTTGATCGCTTGGCTAAACTGCTTCAGAATCCCATCACACATTCACTCCGGGCCTCAGAAAGTGCACA
GGATGATAGCAGAGGGGGACATAGAGCCAGGGAGTGGACTGGGAGGAGGCAACAAAAACAGAAAGGCAAG
CAACACAGGAAGTGGAGTAAGAGCCTAGAGAGGGGCCAGAGTACAGGGGACTTTAGGAAAAGCAAAGTGT
TTTCTCCTCATCAAGGTGGGAAATCCAGTCAGTTCAAGATTGAGCAGATTAAACTAGATAAGTACATCCT
GAGGAAAGAGCCAGGTTTTAATAATGTCAGCAATACCTCCTTGGATTCTAGACCCTCAGAGGAAAGCGTG
TCTCTCACAGATAGTCCCAACATTTTTTCTAGCACGGATTCTCCTGTGGACTCAGATGTATTGACCCCAA
CTGAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 267612. Forward Primer - name:267612_F_cDNA_Alms1, sequence:GACTTGATCGCTTGGCTAAACT; Reverse Primer - name:267612_N_SP6_cDNA_Alms1, sequence:ATCAGTTGGGGTCAATACATCTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:15808 same embryo
 EMAGE:15807 same embryo
 EMAGE:15806 same embryo
 EMAGE:15803 same embryo
 EMAGE:15804 same embryo
 EurExpress:euxassay_013199 same experiment
 MGI:4823091 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS