Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17216

Sostdc1 sclerostin domain containing 1 ( MGI:1913292)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17216 EMAGE:17216 EMAGE:17216 EMAGE:17216 EMAGE:17216
"Pseudo-wholemount" of euxassay_001643. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_001643_01 euxassay_001643_02 euxassay_001643_03 euxassay_001643_04
EMAGE:17216 EMAGE:17216 EMAGE:17216 EMAGE:17216 EMAGE:17216
euxassay_001643_05 euxassay_001643_06 euxassay_001643_07 euxassay_001643_08 euxassay_001643_09
EMAGE:17216 EMAGE:17216 EMAGE:17216 EMAGE:17216 EMAGE:17216
euxassay_001643_10 euxassay_001643_11 euxassay_001643_12 euxassay_001643_13 euxassay_001643_14
EMAGE:17216 EMAGE:17216 EMAGE:17216 EMAGE:17216 EMAGE:17216
euxassay_001643_15 euxassay_001643_16 euxassay_001643_17 euxassay_001643_18 euxassay_001643_19
EMAGE:17216 EMAGE:17216 EMAGE:17216 EMAGE:17216 EMAGE:17216
euxassay_001643_20 euxassay_001643_21 euxassay_001643_22 euxassay_001643_23 euxassay_001643_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17216Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17216_wholemount_strong.wlz
17216_wholemount_moderate.wlz
17216_wholemount_weak.wlz
17216_wholemount_possible.wlz
17216_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17216_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
not examined not examined
regionalnot examined expression: see section 03 04 05
not examined not examined
regionalnot examined expression: see section 03 04
not examined not examined
regionalnot examined expression: see section 03
not examined not examined
regionalnot examined expression: see section 04 05
interdigital region between hindlimb digits 1 and 2 mesenchyme
strong strong
regionalstrong expression: see section 03 04 20 moderate expression: see section 21
interdigital region between hindlimb digits 2 and 3 mesenchyme
strong strong
regionalstrong expression: see section 03 20 moderate expression: see section 21
interdigital region between hindlimb digits 3 and 4 mesenchyme
strong strong
regionalstrong expression: see section 03 20 moderate expression: see section 21
interdigital region between hindlimb digits 4 and 5 mesenchyme
strong strong
regionalstrong expression: see section 04 20 moderate expression: see section 21
head mesenchyme
strong strong
regionalstrong expression: see section 02 03 04 05 06 07 08 09 16 17 18 19 20 21 22
submandibular gland primordium
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 16 17 18 19
epidermis
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
strong strong
regionalstrong expression: see section 03 04 19 20
lateral ventricle choroid plexus
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
4th ventricle lateral recess
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
facial vii ganglion
weak weak
regionalweak expression: see section 03 04 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 07 18
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 16 17 18 19 21 22
vagus x ganglion
weak weak
regionalweak expression: see section 08 17
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 16 17 18 19
cervico-thoracic ganglion
moderate moderate
regionalmoderate expression: see section 09 16
thoracic ganglion
moderate moderate
regionalmoderate expression: see section 12 14 15
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 16 17 18
pharyngo-tympanic tube
strong strong
regionalstrong expression: see section 01 02 03 22 23 24
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 13 14 15 16 17
esophagus
strong strong
regionalstrong expression: see section 12 13
tongue
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15
lower lip
strong strong
regionalstrong expression: see section 06 07 08 09 15 16 17 18
lower jaw incisor
strong strong
regionalstrong expression: see section 09 10 11 13 14 15
oral epithelium
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
upper lip
strong strong
regionalstrong expression: see section 06 07 08 15 16 17 18
upper jaw incisor
strong strong
regionalstrong expression: see section 09 10 11 13 14 15
bladder
moderate moderate
regionalmoderate expression: see section 12 13
kidney calyx
strong strong
regionalstrong expression: see section 07 10 18 19 20
kidney pelvis
strong strong
regionalstrong expression: see section 08 09 16 17
genital tubercle of male
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16
testis
moderate moderate
regionalmoderate expression: see section 05 06 07 08 18 19 20 21
urethra of male
moderate moderate
regionalmoderate expression: see section 13 14
trachea
weak weak
regionalweak expression: see section 11 12 13 14 15
nucleus pulposus
strong strong
regionalstrong expression: see section 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T4821
Entity Detected:Sostdc1, sclerostin domain containing 1 ( MGI:1913292)
Sequence:sense strand is shown

>T4821
CCACGCGTCCGGAAAGAATTAGCGGCTCCTCAGCCCAGCAAATCCTCCACTCATCATGCTTCCTCCTGCC
ATTCATCTCTCTCTCATTCCCCTGCTCTGCATCCTGATGAGAAACTGTTTGGCTTTTAAAAATGATGCCA
CAGAAATCCTTTATTCACATGTGGTTAAACCTGTCCCGGCACACCCCAGCAGCAACAGCACCCTGAATCA
AGCCAGGAATGGAGGCAGGCATTTCAGTAGCACTGGACTGGATCGAAACAGTCGAGTTCAAGTGGGCTGC
AGGGAACTGCGGTCCACCAAATACATTTCGGACGGCCAGTGCACCAGCATCAGCCCTCTGAAGGAGCTGG
TGTGCGCGGGCGAGTGCTTGCCCCTGCCGGTGCTTCCCAACTGGATCGGAGGAGGCTATGGAACAAAGTA
CTGGAGCCGGAGGAGCTCTCAGGAGTGGCGGTGTGTCAACGACAAGACGCGCACCCAGAGGATCCAGCTG
CAGTGTCAGGACGGCAGCACGCGCACCTACAAAATCACCGTGGTCACGGCGTGCAAGTGCAAGAGGTACA
CCCGTCAGCACAACGAGTCCAGCCACAACTTTGAAAGCGTGTCGCCCGCCAAGCCCGCCCAGCACCACAG
AGAGCGGAAGAGAGCCAGCAAATCCAGCAAGCACAGTCTGAGCTAGACCTGGACTGACTAGAAAGCATCT
GCTACCCAGATTTGATTGCTTGGAAGACTCTCTCTCGAGCCTGCCATTGCTCTTTCCTCACTTGAAAGTA
TATGCTTTCTGCTTTGATCAAGCCCAGCAGGCTGTCCTTCTCTGGGACTAGCTTTTCCTTTGCAAGTGTC
TCAAGATGTAATGAGTAGTTTGCAGTGAAAGCCAGGCATCCTGTAGTTTCCATCCCCTCCCCCATCCCAG
TCATTTCTTTAAAAGCACCTGATGCTGCATTCTGTTACAGTTTAAAAAAAAAAAAAAA
Notes:The probe template was PCR amplified from IMAGE:5064413 using vector (pCMV-SPORT6) specific primers. Forward Primer - name:RZPD T7, sequence:TAATACGACTCACTATAGGG; Reverse Primer - name:RZPD sp6, sequence:ATTTAGGTGACACTATAG. Anti-sense probe was then transcribed from the PCR amplified template using Sp6 polymerase. EMAGE Editor's Note: the probe sequence indicated here was given by the EURExpress Consortium and has been checked using a computational method whereby a BLAST comparison was made against the full insert sequence of IMAGE:5064413 which was retrieved directly from NCBI.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17218 same embryo
 EMAGE:17215 same embryo
 EMAGE:17217 same embryo
 EurExpress:euxassay_001643 same experiment
 MGI:4828385 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS