Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17836

Garnl3 GTPase activating RANGAP domain-like 3 ( MGI:2139309)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17836 EMAGE:17836 EMAGE:17836 EMAGE:17836 EMAGE:17836
"Pseudo-wholemount" of euxassay_009037. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009037_01 euxassay_009037_02 euxassay_009037_03 euxassay_009037_04
EMAGE:17836 EMAGE:17836 EMAGE:17836 EMAGE:17836 EMAGE:17836
euxassay_009037_05 euxassay_009037_06 euxassay_009037_07 euxassay_009037_08 euxassay_009037_09
EMAGE:17836 EMAGE:17836 EMAGE:17836 EMAGE:17836 EMAGE:17836
euxassay_009037_10 euxassay_009037_11 euxassay_009037_12 euxassay_009037_13 euxassay_009037_14
EMAGE:17836 EMAGE:17836 EMAGE:17836 EMAGE:17836 EMAGE:17836
euxassay_009037_15 euxassay_009037_16 euxassay_009037_17 euxassay_009037_18 euxassay_009037_19

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17836Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17836_wholemount_strong.wlz
17836_wholemount_moderate.wlz
17836_wholemount_weak.wlz
17836_wholemount_possible.wlz
17836_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17836_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 12 13 weak expression: see section 14
medulla oblongata basal plate marginal layer
moderate moderate
regionalmoderate expression: see section 07 weak expression: see section 06
pons mantle layer
moderate moderate
regionalmoderate expression: see section 15 weak expression: see section 04 05
glossopharyngeal ix ganglion
moderate moderate
single cellmoderate expression: see section 04 05 15
trigeminal v ganglion
moderate moderate
single cellmoderate expression: see section 03 04 05 06 07 16
vagus x ganglion
moderate moderate
single cellmoderate expression: see section 06 14
trigeminal v nerve
moderate moderate
single cellmoderate expression: see section 08 09 16
ventral grey horn
moderate moderate
single cellmoderate expression: see section 04 05 06 07 09 10
dorsal root ganglion
moderate moderate
single cellmoderate expression: see section 03 04 05 09 10 11 12 13
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36418
Entity Detected:Garnl3, GTPase activating RANGAP domain-like 3 ( MGI:2139309)
Sequence:sense strand is shown

>T36418
CTGTAATTTCCCTCATGAAGCCGTGTGTGCAGATCCCTGGGGCCAGGCCTTGCTGGTTTCCACGGATGCT
GGCGTCTTGCTAGTGGACGATGACCTCCCATCCGTGCCCGTGTTTGACAGAACTCTACCTGTGAAGCAGA
TCCACGTGCTGGAGACCCTGGACCTTCTGGTTCTCAGAGCAGACAAAGGGAAAGACGCCCGCCTCTTTGT
CTTCCGGCTCAGTGCTGTGCAGAAAGGCCTTGATGGCAGGCAGACTGGAAGGAGCAGATCTGACTGCCGA
GAAAACAAGCTGGAGAAAACCAAAGGATGCCACCTGTATGCTATTAATACTCACCACAGCAGAGAGCTGA
GAATCGTGGTTGCAATTCGCAATAAACTGCTTCTCATCACAAGGAAACCACACAACAAGCCAAGTGGGGT
GCCAGGTGTCTCACTCCTGTCTCCCCTGTCGGAGTCTCCTGTTGAGGAATTCCAGTACATCAGGGAAATC
TGCCTGTGTGACTCCCCAGCAGTGATGGCCTTAGTGGATGGACCAACGGAAGAGAGCGACAACCTCATCT
GTGTGGCATATCGCCATCAGTTCGACGTGGTAAACGAGAGCACAGGAGAAGCCTTTAGGCTGCACCATGT
GGAGGCCAACAAGGTTAATTTTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 71412. Forward Primer - name:071412_F_cDNA_Garnl3, sequence:CTGTAATTTCCCTCATGAAGCC; Reverse Primer - name:071412_N_SP6_cDNA_Garnl3, sequence:CAAAATTAACCTTGTTGGCCTCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17835 same embryo
 EMAGE:17838 same embryo
 EMAGE:17839 same embryo
 EMAGE:17837 same embryo
 EMAGE:17834 same embryo
 EurExpress:euxassay_009037 same experiment
 MGI:4824995 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS