Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17917

Svil supervillin ( MGI:2147319)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17917 EMAGE:17917 EMAGE:17917 EMAGE:17917 EMAGE:17917
"Pseudo-wholemount" of euxassay_011675. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011675_01 euxassay_011675_02 euxassay_011675_03 euxassay_011675_04
EMAGE:17917 EMAGE:17917 EMAGE:17917 EMAGE:17917 EMAGE:17917
euxassay_011675_05 euxassay_011675_06 euxassay_011675_07 euxassay_011675_08 euxassay_011675_09
EMAGE:17917 EMAGE:17917 EMAGE:17917 EMAGE:17917 EMAGE:17917
euxassay_011675_10 euxassay_011675_11 euxassay_011675_12 euxassay_011675_13 euxassay_011675_14
EMAGE:17917 EMAGE:17917 EMAGE:17917 EMAGE:17917 EMAGE:17917
euxassay_011675_15 euxassay_011675_16 euxassay_011675_17 euxassay_011675_18 euxassay_011675_19
EMAGE:17917 EMAGE:17917 EMAGE:17917 EMAGE:17917 EMAGE:17917
euxassay_011675_20 euxassay_011675_21 euxassay_011675_22 euxassay_011675_23 euxassay_011675_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17917Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17917_wholemount_strong.wlz
17917_wholemount_moderate.wlz
17917_wholemount_weak.wlz
17917_wholemount_possible.wlz
17917_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17917_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
epidermis
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
vibrissa
weak weak
regionalweak expression: see section 03 04 05 06 20 21 22 23
diencephalon meninges
moderate moderate
regionalmoderate expression: see section 15 16 17 18 weak expression: see section 07 08 09 10 11 12 13 14
telencephalon meninges
moderate moderate
regionalmoderate expression: see section 15 16 17 18 20 weak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 19 21 22 23 24
hindbrain meninges
moderate moderate
regionalmoderate expression: see section 15 16 17 18 weak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 19 20
midbrain meninges
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
spinal cord meninges
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13
pharyngo-tympanic tube
moderate moderate
regionalmoderate expression: see section 01 02 21 22 23 24 weak expression: see section 20
tongue muscle
weak weak
regionalweak expression: see section 09 10 11 12 13 14 15
stomach
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 14 15 16 17
midgut
weak weak
regionalweak expression: see section 09 10 11 12 13
exoccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 03 19 20 21 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37101
Entity Detected:Svil, supervillin ( MGI:2147319)
Sequence:sense strand is shown

>T37101
GTCATACGAAGGAGGTTGGAAGGACTGCAGCAAATAAGATCAAGGAAGAATGTCCCCTGGAAGCAGGTTT
GCACAGCAGCAGCAACGTGACAATACATGAGTGTGACGAAGGATCCGAGCCCCTGGGATTCTGGGACGCT
CTGGGGAGGAGGGACAGAAAGGCCTATGACTGCATGCTTCAAGATCCTGGAAGTTTTAACTTCGCGCCCC
GCCTGTTCATCCTCAGCAGCTCCTCCGGAGACTTCTCTGCGACAGAGTTTGTGTACCCCGCACAAGCGCC
CTCTGCCGTCAGCTCCATGCCTTTCCTGCAGGAGGACCTGTACAGCGCGCCGCAGCCAGCTCTCTTCCTT
GTTGACAACCATCACGAGGTGTACCTCTGGCAAGGCTGGTGGCCCACTGAAAACAAGATAACCGGCTCTG
CCCGCATTCGCTGGGCCTCAGACCGGAAGAGTGCCATGGAGACGGTCCTGCAGTACTGCCGAGGAAAGAA
TCTCAAAAGGCCACCCCCCAAGTCTTACCTTATTCATGCTGGGCTAGAGCCCCTGACATTCACCAACATG
TTTCCCAGCTGGGAACACAGAGAAGACATTGCTGA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 92959. Forward Primer - name:092959_F_cDNA_Svil, sequence:GTCATACGAAGGAGGTTGGAAG; Reverse Primer - name:092959_N_SP6_cDNA_Svil, sequence:TCAGCAATGTCTTCTCTGTGTTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17916 same embryo
 EMAGE:17914 same embryo
 EMAGE:17915 same embryo
 EMAGE:17913 same embryo
 EurExpress:euxassay_011675 same experiment
 MGI:4828548 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS