Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:17945

Tex15 testis expressed gene 15 ( MGI:1934816)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:17945 EMAGE:17945 EMAGE:17945 EMAGE:17945 EMAGE:17945
"Pseudo-wholemount" of euxassay_011704. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_011704_01 euxassay_011704_02 euxassay_011704_03 euxassay_011704_04
EMAGE:17945 EMAGE:17945 EMAGE:17945 EMAGE:17945 EMAGE:17945
euxassay_011704_05 euxassay_011704_06 euxassay_011704_07 euxassay_011704_08 euxassay_011704_09
EMAGE:17945 EMAGE:17945 EMAGE:17945 EMAGE:17945 EMAGE:17945
euxassay_011704_10 euxassay_011704_11 euxassay_011704_12 euxassay_011704_13 euxassay_011704_14
EMAGE:17945 EMAGE:17945 EMAGE:17945 EMAGE:17945 EMAGE:17945
euxassay_011704_15 euxassay_011704_16 euxassay_011704_17 euxassay_011704_18 euxassay_011704_19

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:17945Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
17945_wholemount_strong.wlz
17945_wholemount_moderate.wlz
17945_wholemount_weak.wlz
17945_wholemount_possible.wlz
17945_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:17945_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon meninges
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16
telencephalon meninges
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
hindbrain meninges
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17
midbrain meninges
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16
spinal cord mantle layer
weak weak
regionalweak expression: see section 09 13
spinal cord meninges
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14 15 16
saccule mesenchyme
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 16 17
utricle mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 17 18 19
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 09 10 11 12 13 15 16
vomeronasal organ
strong strong
regionalstrong expression: see section 13 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37128
Entity Detected:Tex15, testis expressed gene 15 ( MGI:1934816)
Sequence:sense strand is shown

>T37128
ATTGACTTGGTGCCACATACTGCATCTGTAAATTTTGGAAACACTGTGGCAGAATTAGAACATAACTACA
AGCAGTTTTTTCTATTACTCAAAAATGTAATGTCTGTCCCTCAGAAAGATTTTGGAAAAATGGTTCATAT
TATAAAAGTTATGAAGACAATTGAACATATGAAGCTGCTAAGTGCTAAAGATACTAAATTGTCCACTCAT
CTTCTCTTTCTCCAAATGCTGCGCAACAAAAGGAATGCTTTGCAACAAAACAGACAAGAAAAGATGGAGA
CACCCGTTACAGAACCTGGGGAGGACAGCAGTCAACCTGGGGTTTCTGAGCAGACACCTCCAGGTACAGA
GTGCACAGTAAAAAACATTTCAGACTCCTCTAAAAAGCGACCTGTGACTGCAGACACATGTGAAGTCTCT
CAGGGAAAAGGAAATACAGACACTGTTCCCAGTTGGAAAAAACAAAAGGTTACCATGAAAGATGTTGGAA
ACATACAGACAGTATCCAAACATCCAAGCACTACAGGATCTCCTCCCAATGATGAAAACAAAATAGGATC
AAATTCCTCTGACAGTCTGAAAAGCATCTCTGCATCTCCAGAAGTGGTCAAAAGACAGAGCTCAGTACTT
GGTTCAGTGTCACCTGCTGAAAGTGTACAAGACACTTGCACACCAAAGTCAGAAAGCAAAGTAGAGCCAA
CAGACAGCTTACCTGATTCTTTAGCATCTCTCACTGAACAGCAGGAAAACTCAAATGTCATAGAGAAAAG
AAATGGGAATTCTAGTGTGGCTGAAACAAATGATAAGAAAGACTGTCCTTTAGTAACTTGTGACCAAAAG
GATATAGATGCCTCTTACTCACCTGACCACACACCTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 66325. Forward Primer - name:066325_F_cDNA_Tex15, sequence:ATTGACTTGGTGCCACATACTG; Reverse Primer - name:066325_N_SP6_cDNA_Tex15, sequence:CAGGTGTGTGGTCAGGTGAGT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:17944 same embryo
 EMAGE:17943 same embryo
 EMAGE:17942 same embryo
 EMAGE:17947 same embryo
 EMAGE:17946 same embryo
 EurExpress:euxassay_011704 same experiment
 MGI:4828666 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS