Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18422

Tcam1 testicular cell adhesion molecule 1 ( MGI:1923120)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18422 EMAGE:18422 EMAGE:18422 EMAGE:18422 EMAGE:18422
"Pseudo-wholemount" of euxassay_014376. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_014376_01 euxassay_014376_02 euxassay_014376_03 euxassay_014376_04
EMAGE:18422 EMAGE:18422 EMAGE:18422 EMAGE:18422 EMAGE:18422
euxassay_014376_05 euxassay_014376_06 euxassay_014376_07 euxassay_014376_08 euxassay_014376_09
EMAGE:18422 EMAGE:18422 EMAGE:18422 EMAGE:18422 EMAGE:18422
euxassay_014376_10 euxassay_014376_11 euxassay_014376_12 euxassay_014376_13 euxassay_014376_14
EMAGE:18422 EMAGE:18422 EMAGE:18422 EMAGE:18422 EMAGE:18422
euxassay_014376_15 euxassay_014376_16 euxassay_014376_17 euxassay_014376_18 euxassay_014376_19
EMAGE:18422 EMAGE:18422 EMAGE:18422 EMAGE:18422 EMAGE:18422
euxassay_014376_20 euxassay_014376_21 euxassay_014376_22 euxassay_014376_23 euxassay_014376_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18422Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18422_wholemount_strong.wlz
18422_wholemount_moderate.wlz
18422_wholemount_weak.wlz
18422_wholemount_possible.wlz
18422_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18422_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
humerus
strong strong
regionalstrong expression: see section 01 02 03 04 05 22 23 24
forelimb digit 2 metacarpal
strong strong
regionalstrong expression: see section 02
forelimb digit 2 phalanx
strong strong
regionalstrong expression: see section 02
forelimb digit 3 metacarpal
strong strong
regionalstrong expression: see section 01
forelimb digit 3 phalanx
strong strong
regionalstrong expression: see section 01
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 05 23
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 05 07 08 22 23
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 06 23
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 06 07 08 22 23
hindlimb digit 4 metatarsal
strong strong
regionalstrong expression: see section 06
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 06 07 08 22
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 08
fibula
strong strong
regionalstrong expression: see section 01 02 03 04
tibia
strong strong
regionalstrong expression: see section 01 02 03 04
femur
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 19 20 21 22 23 24
otic capsule
strong strong
regionalstrong expression: see section 08 09 10 11 17 18 19 20 21
nasal septum
strong strong
regionalstrong expression: see section 13
viscerocranium
strong strong
regionalExpression in the turbinate bone.
heart valve
moderate moderate
regionalmoderate expression: see section 15 16
meckel's cartilage
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 13 14 15 16 17 18 19 20 22 23 24
bladder
moderate moderate
regionalmoderate expression: see section 13 14 15 16
axial skeleton
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18 19 20
basioccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
basisphenoid bone
strong strong
regionalstrong expression: see section 09 10 11 12 13 14 15 16 17 18 19 20
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 22 23 24
vault of skull
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 18 19 20 21 22 23 24
clavicle
strong strong
regionalstrong expression: see section 10 19
scapula
strong strong
regionalstrong expression: see section 03 04 05 24
sternum
strong strong
regionalstrong expression: see section 14 15
pelvic girdle skeleton
strong strong
regionalstrong expression: see section 08 09 10 11 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31852
Entity Detected:Tcam1, testicular cell adhesion molecule 1 ( MGI:1923120)
Sequence:sense strand is shown

>T31852
AGCAGAAGGACACCGTGCTCGCTATCACCATGTACCAGCCACCAGAGCAGGTGATACTGGACCTGCAGCC
TGAATGGGTGGCCGTGGATGAAGCCTTCACAGTCACGTGTCATGTACCTAGTGTGGCACCCCTGCAGAGC
CTCACCCTTACCCTCCTCCAGGGTGACCAAGAACTGCACAGAAAAGACTTCCTAAGTTTATCTTTGGTAT
CCCAAAGAGCCGAGGTCACCGCCACTGTCAGAGCCCACCGGGACAATGACAGGCGTAATTTCTCCTGCCG
AGCAGAACTGGATCTGAGCCCACATGGTGGGGGGTTGTTTCACGGCAGCTCAGCCACCAAGCAACTCCGG
ATCTTTGAATTCTCTCAGAATCCCCAGATCTGGGTGCCTTCACTCCTGGAGGTTGGGAAGGCAGAGATTG
TGAGCTGTGAGGTGACCAGAGTATTTCCAGCCCAGGAAGCTGTCTTCCGAATGTTCCTGGAAGACCAGGA
GCTGAGCCCTTTCTCGTCCTGGAGGGAAGATGCAGCGTGGGCCAGTGCCACCATTCAGGCCATGGAGACT
GGTGACCAGGAACTGACTTGCCTTGTGTCTCTGGGTCCCGTGGAGCAGAAAACAAGGAAACCAGTTTATG
TCTACAGTTTCCCTCCACCAATCCTGGAGATAGAAGATGCTTACCCTCTGGCAGGGACGGACGTTAATGT
GACCTGCTCAGGTCACGTGTTAACATCACCTAGCCCTACTCTTCGGCTTCAGGGATCCCTAAACCACTCT
GCCCCTGGGAAGCCTGCCTGGCTTCTGTTTACTGCCAGGGAGGAAGATGATGGCCGGACTCTGTCCTGCG
AGGCCTCTTTGGAGGTACAGGGCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:6741794), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 60895. Forward Primer - name:060895_F_IRAW2_c05_Tcam1, sequence:AGCAGAAGGACACCGTGC; Reverse Primer - name:060895_R_SP6_IRAW2_c05_Tcam1, sequence:TGGCCCTGTACCTCCAAA. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18423 same embryo
 EMAGE:18421 same embryo
 EMAGE:18420 same embryo
 EMAGE:18419 same embryo
 EMAGE:18418 same embryo
 EurExpress:euxassay_014376 same experiment
 MGI:4828628 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS