Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18765

Chd5 chromodomain helicase DNA binding protein 5 ( MGI:3036258)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18765 EMAGE:18765 EMAGE:18765 EMAGE:18765 EMAGE:18765
"Pseudo-wholemount" of euxassay_013995. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013995_01 euxassay_013995_02 euxassay_013995_03 euxassay_013995_04
EMAGE:18765 EMAGE:18765 EMAGE:18765 EMAGE:18765 EMAGE:18765
euxassay_013995_05 euxassay_013995_06 euxassay_013995_07 euxassay_013995_08 euxassay_013995_09
EMAGE:18765 EMAGE:18765 EMAGE:18765 EMAGE:18765 EMAGE:18765
euxassay_013995_10 euxassay_013995_11 euxassay_013995_12 euxassay_013995_13 euxassay_013995_14
EMAGE:18765 EMAGE:18765 EMAGE:18765 EMAGE:18765 EMAGE:18765
euxassay_013995_15 euxassay_013995_16 euxassay_013995_17 euxassay_013995_18 euxassay_013995_19
EMAGE:18765 EMAGE:18765 EMAGE:18765 EMAGE:18765
euxassay_013995_20 euxassay_013995_21 euxassay_013995_22 euxassay_013995_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18765Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18765_wholemount_strong.wlz
18765_wholemount_moderate.wlz
18765_wholemount_weak.wlz
18765_wholemount_possible.wlz
18765_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18765_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18
telencephalon mantle layer
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata alar plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
medulla oblongata basal plate mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
rest of cerebellum mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
pons mantle layer
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain mantle layer
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 12 13 14 15 16 17 18 19
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 18 20 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 08 18 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 08 18
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 19
spinal cord mantle layer
strong strong
regionalstrong expression: see section 11 12 13 14 15 16 17 18
dorsal root ganglion
strong strong
regionalstrong expression: see section 10 11 12 13 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39629
Entity Detected:Chd5, chromodomain helicase DNA binding protein 5 ( MGI:3036258)
Sequence:sense strand is shown

>T39629
TATGTATCACTCTTCATGCGCCACCTGTGTGAGCCGGGCGCAGACGGCGCGGAGACCTTCGCAGACGGCG
TGCCCCGGGAGGGCCTGTCTAGGCAGCACGTGCTCACGCGTATTGGGGTCATGTCGCTGGTTAGGAAGAA
GGTGCAGGAGTTTGAGCATGTCAACGGCAAGTACAGCACCCCAGACCTGGTCCCCGAGGGGGCCGAGGGC
AAGAAGCCGGGCGAGGTCATCTCCTCAGACCCCAACACACCTGTGCCTGCCAGCCCTGCACAGCTTCCAC
CGGCCCCACTGGGCCTGACAGACAAAATGGAAGCCCAGCTGGGCTACACAGATGAGAAGGAGTCAGGCAT
GCAGAAGCCAAAGAAGTCCCTGGAAATCCAGACCCTGCCAACTGCCCTGGACAGAGTAGAGGGTGAAGAC
AAACATCAGAGCTCAGACAGCAAGGACAGGGCTCGGGAGGAGAGGACAGAAGAGGTGGAGAAGGCCCAGG
GGTCTCCAGAGCAGCCACTGAAAGAGGAAGTGCTGCCGGACAAGGAGCCGATCCCAGACAAGCCGGAGCT
GAGCTTGGGTCACAGCGGGGATTTCAGGCCAGGTGGGCGCTTCTTCCTGTGCCCTGCCACAGGCCTCCTG
GGCAGCCATCTGGATGACCCCAAGACTGAGGAGAAGGAGCCC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 78413. Forward Primer - name:078413_F_cDNA_Chd5, sequence:TATGTATCACTCTTCATGCGCC; Reverse Primer - name:078413_N_SP6_cDNA_Chd5, sequence:GGGCTCCTTCTCCTCAGTCTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18764 same embryo
 EMAGE:18761 same embryo
 EMAGE:18763 same embryo
 EMAGE:18762 same embryo
 EMAGE:18766 same embryo
 EurExpress:euxassay_013995 same experiment
 MGI:4823839 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS