Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18943

LOC671981 (LOC671981)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18943 EMAGE:18943 EMAGE:18943 EMAGE:18943 EMAGE:18943
"Pseudo-wholemount" of euxassay_015958. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015958_01 euxassay_015958_02 euxassay_015958_03 euxassay_015958_04
EMAGE:18943 EMAGE:18943 EMAGE:18943 EMAGE:18943 EMAGE:18943
euxassay_015958_05 euxassay_015958_06 euxassay_015958_07 euxassay_015958_08 euxassay_015958_09
EMAGE:18943 EMAGE:18943 EMAGE:18943 EMAGE:18943 EMAGE:18943
euxassay_015958_10 euxassay_015958_11 euxassay_015958_12 euxassay_015958_13 euxassay_015958_14
EMAGE:18943 EMAGE:18943 EMAGE:18943 EMAGE:18943 EMAGE:18943
euxassay_015958_15 euxassay_015958_16 euxassay_015958_17 euxassay_015958_18 euxassay_015958_19
EMAGE:18943 EMAGE:18943 EMAGE:18943 EMAGE:18943
euxassay_015958_20 euxassay_015958_21 euxassay_015958_22 euxassay_015958_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18943Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18943_wholemount_strong.wlz
18943_wholemount_moderate.wlz
18943_wholemount_weak.wlz
18943_wholemount_possible.wlz
18943_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18943_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
submandibular gland primordium
weak weak
regionalweak expression: see section 05 06 14 15
facial vii ganglion
weak weak
regionalweak expression: see section 02 03 04 18 19
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 05 15 16
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 07 15 16 17 18 19 20 21
trigeminal v nerve
weak weak
regionalweak expression: see section 15
dorsal root ganglion
weak weak
regionalweak expression: see section 05 07 08 13 14
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T40520
Entity Detected:LOC671981, (LOC671981)
Sequence:sense strand is shown

>T40520
GGTCCTGCTTTCTGAAATCCTACACCTTCTATGCAGACAAATGAAGTTGGACTTCACGGAATCCGAAGGG
CCCTGCTCCTCTGAGGCACTGTCAAAGAAGGAGCTGTCTGCCGAGGAGCTGTCTCAGCGCCTGGAAAAGC
TCATCATGGAGGAGAAAGCGGATGACGAGCGGATCTTTGACTGGGTGGAGGCTAATCTCGACGAAAGCCA
GATGAGTTCGCCTACATTCCTTAGAGCTTTAATGACAGCCGTTTGCAAAGCAGCTATCATAGCTGACTGT
TCTACCTTCAGAGTGGACACTGCTGTGATCAAGCAGAGAGTGCCGATCTTACTCAAGTACCTAGACTCAG
ACACGGAGAAGGAACTACAAGCACTTTATGCACTACAAGCATCCATAGTAAAACTTGACCAACCTGCCAA
CTTG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 164157. Forward Primer - name:164157_F_cDNA_mCG14542.1, sequence:GGTCCTGCTTTCTGAAATCCTA; Reverse Primer - name:164157_N_SP6_cDNA_mCG14542.1, sequence:CAAGTTGGCAGGTTGGTCAAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18944 same embryo
 EMAGE:18942 same embryo
 EMAGE:18945 same embryo
 EurExpress:euxassay_015958 same experiment
 MGI:4824516 same experiment
  Allen Brain Atlas same gene
  BioGPS same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS