Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:18976

Ncan neurocan ( MGI:104694)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:18976 EMAGE:18976 EMAGE:18976 EMAGE:18976 EMAGE:18976
"Pseudo-wholemount" of euxassay_015922. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015922_01 euxassay_015922_02 euxassay_015922_03 euxassay_015922_04
EMAGE:18976 EMAGE:18976 EMAGE:18976 EMAGE:18976 EMAGE:18976
euxassay_015922_05 euxassay_015922_06 euxassay_015922_07 euxassay_015922_08 euxassay_015922_09
EMAGE:18976 EMAGE:18976 EMAGE:18976 EMAGE:18976 EMAGE:18976
euxassay_015922_10 euxassay_015922_11 euxassay_015922_12 euxassay_015922_13 euxassay_015922_14
EMAGE:18976 EMAGE:18976 EMAGE:18976 EMAGE:18976 EMAGE:18976
euxassay_015922_15 euxassay_015922_16 euxassay_015922_17 euxassay_015922_18 euxassay_015922_19
EMAGE:18976 EMAGE:18976 EMAGE:18976 EMAGE:18976 EMAGE:18976
euxassay_015922_20 euxassay_015922_21 euxassay_015922_22 euxassay_015922_23 euxassay_015922_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:18976Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
18976_wholemount_strong.wlz
18976_wholemount_moderate.wlz
18976_wholemount_weak.wlz
18976_wholemount_possible.wlz
18976_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:18976_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon
strong strong
homogeneousstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
telencephalon
strong strong
homogeneousstrong expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
hindbrain
strong strong
homogeneousstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
midbrain
strong strong
homogeneousstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21
facial vii ganglion
weak weak
regionalweak expression: see section 05 06 07 19 20 21
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 18 19
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 17 18 19 20 21 22 23
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 07 18 19
trigeminal v nerve
weak weak
regionalweak expression: see section 09
not examined not examined
homogeneousnot examined expression: see section 17
ventral grey horn
strong strong
single cellstrong expression: see section 12 13 14 15
intermediate grey horn
strong strong
single cellstrong expression: see section 13 14
dorsal root ganglion
weak weak
regionalweak expression: see section 09 10 11 15 16 17
neural retina
weak weak
regionalweak expression: see section 01 02 03 22 23 24
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63368
Entity Detected:Ncan, neurocan ( MGI:104694)
Sequence:sense strand is shown

>T63368
CTTAGCCCTGTGGGTAAAGATGCTGCATAAGCCTGAAGAAGTCCGTTTAAGCCCTGGGACCCATGTTTTA
AAAGTGAAAAGCCAGGTAGGGTGTGAACCCTGGTGCCAGCATCCCTGTGCTGAGACTATAGGAAGCTCAT
GAGCCAGCTAGCCTGGAGGATCACGGCAAACCCTTAAAGGGTAGCATTTGACCTCCACTGCACACTACAA
TGTGGGTGATTCTCCAACACACGCACAACCCTCTCCCCCCACACACACTGCACAAGCACAAAATAAATAA
GTAAAAATTTCAAAAACTGTAGGATTGGGTGGGTCAGGGCAGGGATGGGTGCACAGGTTCTGGGGTCCAT
GCCCAGCTCTTCCTAAGTGTTTACTGAGCTGCATTGCTCACAGGAGGTAATGAAAGCCTGGGGCAGTTAC
TGAATAGAAGCCGTGTAAAGCCTTGTGAGATGCCCTTGAATCCTCTCAGCAGCCCACGTGGTCCTTAGTC
TCCCATTTCCACTTGATTGTAAGAGAAAGACAAAGTTACAGACTACGATAGAGGAGCTAGAGCAAGAATT
TCCTTCTGTGCGTTATAATTACTGTAAGTGTTGATTTTTTGGACAGGGCCTCAGTCTGGCCTTGAATTCA
CTCAGTAGCTGAGGATAACCTTAAAGTCCTGATCCTTCTGCCTCAGTTTCCCAAG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 96444. Forward Primer - name:096444_F_cDNA_Cspg3, sequence:CTTAGCCCTGTGGGTAAAGATG; Reverse Primer - name:096444_N_SP6_cDNA_Cspg3, sequence:CTTGGGAAACTGAGGCAGAAG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:18970 same embryo
 EMAGE:18973 same embryo
 EMAGE:18974 same embryo
 EMAGE:18975 same embryo
 EMAGE:18972 same embryo
 EMAGE:18971 same embryo
 EMAGE:18969 same embryo
 EurExpress:euxassay_015922 same experiment
 MGI:4826610 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS