Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19062

Eif4g3 eukaryotic translation initiation factor 4 gamma, 3 ( MGI:1923935)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19062 EMAGE:19062 EMAGE:19062 EMAGE:19062 EMAGE:19062
"Pseudo-wholemount" of euxassay_015952. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015952_01 euxassay_015952_02 euxassay_015952_03 euxassay_015952_04
EMAGE:19062 EMAGE:19062 EMAGE:19062 EMAGE:19062 EMAGE:19062
euxassay_015952_05 euxassay_015952_06 euxassay_015952_07 euxassay_015952_08 euxassay_015952_09
EMAGE:19062 EMAGE:19062 EMAGE:19062 EMAGE:19062 EMAGE:19062
euxassay_015952_10 euxassay_015952_11 euxassay_015952_12 euxassay_015952_13 euxassay_015952_14
EMAGE:19062 EMAGE:19062 EMAGE:19062 EMAGE:19062 EMAGE:19062
euxassay_015952_15 euxassay_015952_16 euxassay_015952_17 euxassay_015952_18 euxassay_015952_19
EMAGE:19062 EMAGE:19062 EMAGE:19062 EMAGE:19062
euxassay_015952_20 euxassay_015952_21 euxassay_015952_22 euxassay_015952_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19062Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19062_wholemount_strong.wlz
19062_wholemount_moderate.wlz
19062_wholemount_weak.wlz
19062_wholemount_possible.wlz
19062_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19062_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16
telencephalon
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
hindbrain
weak weak
regionalweak expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
midbrain
weak weak
regionalweak expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18
facial vii ganglion
weak weak
regionalweak expression: see section 03 04 18 19 20
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 06 07 16 17
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 07 16 17 18 19 20
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 06 16 17
trigeminal v nerve
weak weak
regionalweak expression: see section 15
spinal cord
weak weak
regionalweak expression: see section 10 11 12 13 14 15 16
dorsal root ganglion
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 16 17
neural retina
weak weak
regionalweak expression: see section 01 21 22
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63305
Entity Detected:Eif4g3, eukaryotic translation initiation factor 4 gamma, 3 ( MGI:1923935)
Sequence:sense strand is shown

>T63305
CAGAAGAGGAAGTGGAGAGGAAGTCCAAGTCTATCATTGACGAATTCTTACACATCAATGACTTTAAGGA
GGCCACGCAGTGCATAGAGGAGCTGAGCGCCCAGGGCCCACTGCATGTGTTCGTGAAGGTGGGTGTGGAG
TTCACCCTGGAACGGAGCCAGATCACCAGGGACCACATGGGCCACTTACTGTATCAGCTGGTGCAGTCAG
AAAAACTCAGCAAGCAGGACTTTTTCAAAGGTTTTTCTGAAACCTTGGAGTTGGCAGATGACATGGCCAT
TGATATTCCCCATATTTGGTTGTACCTGGCTGAACTGGTCACCCCCATGTTAAAAGGAGGGGGGATTTCC
ATGAGAGAACTTATTGTGGAATTCAGCAAGCCATTACTTCCTGTTGGCAGAGCTGGGGTCCTGCTTTCTG
AAATCCTACACCTTCTATGCAGACAAATGAGCCATAAGAAAGTAGGCGCCCTGTGGAGGGAGGCTGACCT
CAGCTGGAAGGACTTTTTACCGGAAGGGGAAGATGTCCATCATTTTCTCTTGGAGCAGAAGTTGGACTTC
ACGGAATCCGAAGGGCCCTGCTCCTCTGAGGCACTGTCAAAGAAGGAGCTGTCTGCCGAGGAGCTGTCTC
AGCGCCTGGAAAAGCTCATCATGGAGGAGAAAGCGGATGACGAGCGGATCTTTGACT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 88601. Forward Primer - name:088601_F_cDNA_Eif4g3, sequence:CAGAAGAGGAAGTGGAGAGGAA; Reverse Primer - name:088601_N_SP6_cDNA_Eif4g3, sequence:AGTCAAAGATCCGCTCGTCAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19063 same embryo
 EMAGE:19064 same embryo
 EMAGE:19065 same embryo
 EMAGE:19066 same embryo
 EMAGE:19067 same embryo
 EurExpress:euxassay_015952 same experiment
 MGI:4824515 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS