Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19072

Lamp1 lysosomal-associated membrane protein 1 ( MGI:96745)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19072 EMAGE:19072 EMAGE:19072 EMAGE:19072 EMAGE:19072
"Pseudo-wholemount" of euxassay_015957. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_015957_01 euxassay_015957_02 euxassay_015957_03 euxassay_015957_04
EMAGE:19072 EMAGE:19072 EMAGE:19072 EMAGE:19072 EMAGE:19072
euxassay_015957_05 euxassay_015957_06 euxassay_015957_07 euxassay_015957_08 euxassay_015957_09
EMAGE:19072 EMAGE:19072 EMAGE:19072 EMAGE:19072 EMAGE:19072
euxassay_015957_10 euxassay_015957_11 euxassay_015957_12 euxassay_015957_13 euxassay_015957_14
EMAGE:19072 EMAGE:19072 EMAGE:19072 EMAGE:19072 EMAGE:19072
euxassay_015957_15 euxassay_015957_16 euxassay_015957_17 euxassay_015957_18 euxassay_015957_19
EMAGE:19072
euxassay_015957_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19072Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19072_wholemount_strong.wlz
19072_wholemount_moderate.wlz
19072_wholemount_weak.wlz
19072_wholemount_possible.wlz
19072_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19072_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12
medulla oblongata floor plate
strong strong
regionalstrong expression: see section 09 10
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 11 12
metencephalon floor plate
strong strong
regionalstrong expression: see section 09 10
pons ventricular layer
strong strong
regionalstrong expression: see section 04 05 moderate expression: see section 06 07 08 11 12 13 14 15
midbrain floor plate
strong strong
regionalstrong expression: see section 10
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 11 12 13 14
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 04 05 13 14
trigeminal v ganglion
weak weak
regionalweak expression: see section 01 02 03 04 05 06 14 15 16 17 18 19
ventral grey horn
moderate moderate
regionalmoderate expression: see section 07 09 10 11 weak expression: see section 08 13
dorsal root ganglion
weak weak
regionalweak expression: see section 05 06 12 13 14
neural retina
weak weak
regionalweak expression: see section 01 19 20
mandible
weak weak
regionalweak expression: see section 01 02 03 04 05 06 13 14 18 19
maxilla
weak weak
regionalweak expression: see section 03 04 05 06 14
orbito-sphenoid
weak weak
regionalweak expression: see section 01 02 03 18 19 20
sternum
moderate moderate
regionalmoderate expression: see section 09
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T63274
Entity Detected:Lamp1, lysosomal-associated membrane protein 1 ( MGI:96745)
Sequence:sense strand is shown

>T63274
CGGGTCTACATGAAGAATGTGACCGTTGTGCTCCGGGATGCCACTATCCAGGCCTACCTGTCGAGTGGCA
ACTTCAGCAAGGAAGAGACACACTGCACACAGGATGGACCTTCCCCAACCACTGGGCCACCCAGCCCCTC
ACCACCACTTGTGCCCACAAACCCCACTGTATCCAAGTACAATGTTACTGGTAACAACGGAACCTGCCTG
CTGGCCTCTATGGCACTGCAACTGAATATCACCTACCTGAAAAAGGACAACAAGACGGTGACCAGAGCGT
TCAACATCAGCCCAAATGACACATCTAGTGGGAGTTGCGGTATCAACTTGGTGACCCTGAAAGTGGAGAA
CAAGAACAGAGCCCTGGAATTGCAGTTTGGGATGAATGCCAGCTCTAGCCTGTTTTTCTTGCAAGGAGTG
CGCTTGAATATGACTCTTCCTGATGCCCTAGTGCCCACATTCAGCATCTCCAACCATTCACTGAAAGCTC
TTCAGGCCACTGTGGGAAACTCATACAAGTGCAACACTGAGGAACACATCTTTGTCAGCAAGATGCTCTC
CCTCAATGTCTTCAGTGTGCAGGTCCAGGCTTTCAAGGTGGACAGTGACAGGTTTGGGTCTGTGGAAGAG
TGTGTTCAGGATGGTAACAACATGTTGATCCCCATTGCTGTGGGCGGTGCCCTGGCAGGGCTGATCCTCA
TCGTCCTCATTGCCTACCTCATTGGCAGGAAGAGGAGTCACGCCGGCTATCAGACCATCTAGCCTGGTGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 99209. Forward Primer - name:099209_F_cDNA_Lamp1, sequence:CGGGTCTACATGAAGAATGTGA; Reverse Primer - name:099209_N_SP6_cDNA_Lamp1, sequence:CCACCAGGCTAGATGGTCTGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19073 same embryo
 EMAGE:19071 same embryo
 EMAGE:19069 same embryo
 EMAGE:19070 same embryo
 EMAGE:19068 same embryo
 EurExpress:euxassay_015957 same experiment
 MGI:4825865 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS