Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19184

Fbxo32 F-box protein 32 ( MGI:1914981)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19184 EMAGE:19184 EMAGE:19184 EMAGE:19184 EMAGE:19184
"Pseudo-wholemount" of euxassay_009279. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009279_01 euxassay_009279_02 euxassay_009279_03 euxassay_009279_04
EMAGE:19184 EMAGE:19184 EMAGE:19184 EMAGE:19184 EMAGE:19184
euxassay_009279_05 euxassay_009279_06 euxassay_009279_07 euxassay_009279_08 euxassay_009279_09
EMAGE:19184 EMAGE:19184 EMAGE:19184 EMAGE:19184 EMAGE:19184
euxassay_009279_10 euxassay_009279_11 euxassay_009279_12 euxassay_009279_13 euxassay_009279_14
EMAGE:19184 EMAGE:19184 EMAGE:19184 EMAGE:19184 EMAGE:19184
euxassay_009279_15 euxassay_009279_16 euxassay_009279_17 euxassay_009279_18 euxassay_009279_19
EMAGE:19184 EMAGE:19184 EMAGE:19184 EMAGE:19184
euxassay_009279_20 euxassay_009279_21 euxassay_009279_22 euxassay_009279_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19184Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19184_wholemount_strong.wlz
19184_wholemount_moderate.wlz
19184_wholemount_weak.wlz
19184_wholemount_possible.wlz
19184_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19184_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
sublingual gland primordium
strong strong
regionalstrong expression: see section 11 12 13
telencephalon ventricular layer
weak weak
regionalweak expression: see section 03 04 05 06
midbrain ventricular layer
weak weak
regionalweak expression: see section 08 09 10 11 12 13 14
intermediate grey horn
moderate moderate
single cellmoderate expression: see section 05 06 07 08 09
cochlea
strong strong
regionalstrong expression: see section 03 04 05 15 16 17 moderate expression: see section 01 02 14
cochlear duct
strong strong
regionalstrong expression: see section 13
nasal cavity olfactory epithelium
strong strong
regionalstrong expression: see section 07 08 09 10 12 13 14 15 16
vomeronasal organ
strong strong
regionalstrong expression: see section 09 12
heart atrium
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12
esophagus
weak weak
regionalweak expression: see section 07 08
lower lip
moderate moderate
regionalmoderate expression: see section 06 07 13 14 15
tail mesenchyme
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3490
Entity Detected:Fbxo32, F-box protein 32 ( MGI:1914981)
Sequence:sense strand is shown

>T3490
TGGCCTCGAGCCAGATTCGGCACGAGGGCAANCGTTTGATCTTGTCTGACAAAGGGCAGCTGGATTGGAA
GAAGATGTATTTTAAGCTTGTACGATGTTACCCAAGAAGAGAGCAGTATGGGGTCACCCTGCAGCTTTGC
AAACACTGCCACATTCTCTCCTGGAAGGGCACTGACCATCCGTGCACGGCCAACAACCCAGAGAGCTGCT
CCGTCTCACTTTCCCCTCAAGACTTTATCAATTTGTTCAAGTTCTGAATAATCCCAGCACACGACAACAC
TTCAGAAGGCTTCTAATTGGATGGCTGGGAGTCGGGACACTTCATTTGTAAATAGTGTACATTTTAAGCA
TTGGCTTGAAACTGCGGGGGATACGTCATTGAGGAGACGTTGGCGGGGAAGAGATGCAGTTGCCGATGGA
AATTTACAAATGTGAATTCCACATGAGAACTGGTACAGAAAAGCAGAAATACTGTAAATAGACTTTTTAT
TTTCCCTAACGATTTGCAAGCAAGACTATAAAGGCAAGAACTCTATGTCAGCCATGGAAACGG
Notes:The probe template was PCR amplified from IMAGE:333866 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:333866 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19186 same embryo
 EMAGE:19185 same embryo
 EurExpress:euxassay_009279 same experiment
 MGI:4824805 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS