Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19724

Kif23 kinesin family member 23 ( MGI:1919069)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19724 EMAGE:19724 EMAGE:19724 EMAGE:19724 EMAGE:19724
"Pseudo-wholemount" of euxassay_006188. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006188_01 euxassay_006188_02 euxassay_006188_03 euxassay_006188_04
EMAGE:19724 EMAGE:19724 EMAGE:19724 EMAGE:19724 EMAGE:19724
euxassay_006188_05 euxassay_006188_06 euxassay_006188_07 euxassay_006188_08 euxassay_006188_09
EMAGE:19724 EMAGE:19724 EMAGE:19724 EMAGE:19724 EMAGE:19724
euxassay_006188_10 euxassay_006188_11 euxassay_006188_12 euxassay_006188_13 euxassay_006188_14
EMAGE:19724 EMAGE:19724 EMAGE:19724 EMAGE:19724 EMAGE:19724
euxassay_006188_15 euxassay_006188_16 euxassay_006188_17 euxassay_006188_18 euxassay_006188_19
EMAGE:19724 EMAGE:19724 EMAGE:19724 EMAGE:19724
euxassay_006188_20 euxassay_006188_21 euxassay_006188_22 euxassay_006188_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19724Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19724_wholemount_strong.wlz
19724_wholemount_moderate.wlz
19724_wholemount_weak.wlz
19724_wholemount_possible.wlz
19724_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19724_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 09 10 12 13
submandibular gland primordium
strong strong
regionalstrong expression: see section 06 15 16 moderate expression: see section 05 07 08 14 17
thyroid gland
weak weak
regionalweak expression: see section 09 13
hypothalamus ventricular layer
strong strong
regionalstrong expression: see section 12 13 14
diencephalon lateral wall ventricular layer
strong strong
regionalstrong expression: see section 12 13 14
olfactory cortex ventricular layer
strong strong
homogeneousstrong expression: see section 10 11 15 16
telencephalon ventricular layer
strong strong
homogeneousstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 13
medulla oblongata basal plate ventricular layer
strong strong
regionalstrong expression: see section 09 moderate expression: see section 08 11 12 13 14 15
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 13 14 15 16 17 18 19 20 21
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 13 14 15 16 17 18 19 20 21
midbrain ventricular layer
strong strong
regionalstrong expression: see section 08 09 10 12 13 14 15 16 17
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 weak expression: see section 09
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 16 17
lower jaw incisor
weak weak
regionalweak expression: see section 09 10 12 13 14
upper jaw incisor
weak weak
regionalweak expression: see section 09 10 12 13 14
lung
moderate moderate
regionalmoderate expression: see section 14 weak expression: see section 01 02 03 04 05 06 07 08 09 11 12 13 15 16 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T538
Entity Detected:Kif23, kinesin family member 23 ( MGI:1919069)
Sequence:sense strand is shown

>T538
TCNAGCCTGTTGGCCTACTGGATATATGATCTATTGGAAGAAGTGCAGTTTGATCCCATAAAGCCCAAAC
TCCCACAATCTAAAACGCTCCGAGAAGATAAGAACCACAATATGTATGTGGCAGGATGTACAGAAGTAGA
AGTGAAATCTACGGAGGAGGCTTTTGAGGTTTTCTGGAGAGGGCAGAAAAAGAGACGCATTGCTAACACC
CATTTGAATAGAGAGTCCAGTCGTTCACATAGCGTGTTCAGCATTAAACTTGTCCAGGCTCCCCTGGATG
CTGATGGAGACAATGTCTTACAGGAAAAAGAGCAAATTACTATAAGCCAGCTGTCTCTGGTAGATCTTGC
TGGGAGCGAAAGAACCAACCGTACTAAAGCAGAAGGGAACAGACTACGTGAGGCCGGAAACATTAATCAG
TCATTGATGACACTAAGAACATGCATGGAGGTCCTGAGAGAGAACCAGACGTATGGCACTAACAAGATGG
TTCCATATCGAGATTCAAAGCTAACCCATCTATTCAAGAACTGCTTCGATGGGGAGG
Notes:The probe template was PCR amplified from IMAGE:1498851 using vector specific primers. Forward Primer - name:T7-pME18S-FL3-fw, sequence:CGTAATACGACTCACTATAGGGCCTTCTGCTCTAAAAGCTGCG; Reverse Primer - name:T3-pME18S-FL3-rv, sequence:CAAATTAACCCTCACTAAAGGGCGACCTGCAGCTCGAGCAC. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1498851 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19725 same embryo
 EMAGE:19728 same embryo
 EMAGE:19726 same embryo
 EMAGE:19723 same embryo
 EMAGE:19727 same embryo
 EurExpress:euxassay_006188 same experiment
 MGI:4825759 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS