Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19773

Sipa1l2 signal-induced proliferation-associated 1 like 2 ( MGI:2676970)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19773 EMAGE:19773 EMAGE:19773 EMAGE:19773 EMAGE:19773
"Pseudo-wholemount" of euxassay_006320. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_006320_01 euxassay_006320_02 euxassay_006320_03 euxassay_006320_04
EMAGE:19773 EMAGE:19773 EMAGE:19773 EMAGE:19773 EMAGE:19773
euxassay_006320_05 euxassay_006320_06 euxassay_006320_07 euxassay_006320_08 euxassay_006320_09
EMAGE:19773 EMAGE:19773 EMAGE:19773 EMAGE:19773 EMAGE:19773
euxassay_006320_10 euxassay_006320_11 euxassay_006320_12 euxassay_006320_13 euxassay_006320_14
EMAGE:19773 EMAGE:19773 EMAGE:19773 EMAGE:19773 EMAGE:19773
euxassay_006320_15 euxassay_006320_16 euxassay_006320_17 euxassay_006320_18 euxassay_006320_19
EMAGE:19773 EMAGE:19773
euxassay_006320_20 euxassay_006320_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19773Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19773_wholemount_strong.wlz
19773_wholemount_moderate.wlz
19773_wholemount_weak.wlz
19773_wholemount_possible.wlz
19773_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19773_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 07 08 09 10 11
diencephalon lateral wall mantle layer
weak weak
regionalweak expression: see section 06 07 08 09 10 11 12 13 14 15 16
telencephalon mantle layer
weak weak
regionalweak expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 05 13 weak expression: see section 04 10 11 12
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 01 05 06 09 13 14 15 16 17 weak expression: see section 02 03 04 10 11 12
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09
midbrain mantle layer
weak weak
regionalweak expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T35001
Entity Detected:Sipa1l2, signal-induced proliferation-associated 1 like 2 ( MGI:2676970)
Sequence:sense strand is shown

>T35001
CATGGACAAGAACTAGAAGGGGCCCCAGAGCTGTCCTTGTGTGTAGATCCCACCAGTGGCAAAGAGTTCA
TGGATACACCTGGGGAGCGATCGCCCTCCACACTGACTGGGAAAGTTAACCAGCTAGAACTGATTCTCCG
ACAACTGCAGACTGACCTTCGGAAGGAGAAGCAGGACAAGGCGGTGCTGCAGGCTGAGGTCCAGCACCTG
AGGCAGGACAACATGCGGCTGCAGGAAGAGTCACAGACAGCCACAGCCCAGCTGCGCAAGTTCACCGAGT
GGTTTTTTAGCACCATTGACAAGAAGGCCTGATCAGCTCGCTGCTCCTCACCTTGGGACCACGGGCTGGT
CGGCCTGCCTGCCTGCCACCCTGCCTACCCGTGGTCCCTTCCAAGTCAGCAAAGCAGTTTTTACATGTGC
TTTCCATCACCTGTAGGTAGATGTCTCACTGTCTGTCTGTGTCTCTACTCACCCCAGCAGGCAGGTCAGG
GGCCTGGACTCCCGCATAGCTGCAGCAGAAGATGAATGTAACTGCTGGTGGATGCTGACAGCCTGTAGCC
GAGTGGTTTCCCTGACGATGCTCGGGTCTCCTTCCTGTGGGGAGAGAACCTAGGCAGGTGACCTGCAGAG
ATGCTAAGCCAGTGGACTATGGCAGGGCTGTAGGGCTGTAAAATAACTATGGAGACGAGAATCAGACATG
TACTTTAATGTTAAAGGTGCTCTATTTTTCGGATGTACAGTAGTTTTATTTCCACAGCCGCATTATCATA
GCAATAAGAAGGGCACGCAGTAGG
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 50005. Forward Primer - name:050005_F_cDNA_Sipa1l2, sequence:CATGGACAAGAACTAGAAGGGG; Reverse Primer - name:050005_N_SP6_cDNA_Sipa1l2, sequence:CCTACTGCGTGCCCTTCTTAT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19777 same embryo
 EMAGE:19774 same embryo
 EMAGE:19776 same embryo
 EMAGE:19772 same embryo
 EMAGE:19775 same embryo
 EurExpress:euxassay_006320 same experiment
 MGI:4828077 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS