Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:19982

Sdk1 sidekick homolog 1 (chicken) ( MGI:2444413)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:19982 EMAGE:19982 EMAGE:19982 EMAGE:19982 EMAGE:19982
"Pseudo-wholemount" of euxassay_009453. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_009453_01 euxassay_009453_02 euxassay_009453_03 euxassay_009453_04
EMAGE:19982 EMAGE:19982 EMAGE:19982 EMAGE:19982 EMAGE:19982
euxassay_009453_05 euxassay_009453_06 euxassay_009453_07 euxassay_009453_08 euxassay_009453_09
EMAGE:19982 EMAGE:19982 EMAGE:19982 EMAGE:19982 EMAGE:19982
euxassay_009453_10 euxassay_009453_11 euxassay_009453_12 euxassay_009453_13 euxassay_009453_14
EMAGE:19982 EMAGE:19982 EMAGE:19982 EMAGE:19982 EMAGE:19982
euxassay_009453_15 euxassay_009453_16 euxassay_009453_17 euxassay_009453_18 euxassay_009453_19
EMAGE:19982 EMAGE:19982 EMAGE:19982
euxassay_009453_20 euxassay_009453_21 euxassay_009453_22

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:19982Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
19982_wholemount_strong.wlz
19982_wholemount_moderate.wlz
19982_wholemount_weak.wlz
19982_wholemount_possible.wlz
19982_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:19982_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 17 18 19 weak expression: see section 16 20 21
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 05 06 07 09 13 14 weak expression: see section 08 15
neural retina
moderate moderate
regionalmoderate expression: see section 01 02 weak expression: see section 03 22
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 10 11 12 14 15 16 17 weak expression: see section 08 09 18
vomeronasal organ
moderate moderate
regionalmoderate expression: see section 11 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36996
Entity Detected:Sdk1, sidekick homolog 1 (chicken) ( MGI:2444413)
Sequence:sense strand is shown

>T36996
AAAATGAAGGTCCTCTTCCTCCCCGAGCCTGTGGTGAAGATCAAGGATCTCACCAGCCACACAAAGTACC
TGATCAGCATCTCAGCCTTCAATGCTGCTGGTGATGGGCCCAAGAGTGACCCGTGCCAAGGACGCACACA
TCAGGCGGCTCCAGGGCCCCCCAGCTTCTTGGCATTCTCAGAAATAACTTCTACCACACTCAACGTATCC
TGGGGAGAGCCATCAGCTGCCAACGGCATCCTACAGGGCTATCGAGTGGTGTATGAGCCCTTAGCACCAG
TGCAAGGCGTGAGCAAGGTGGTGACCGTGGACGTGAAAGGCAACTGGCAACGTTGGCTGAAGGTGCGGGA
CCTCACCAAGGGAGTGACCTACTTCTTCCGTGTCCAGGCGCGGACCATCGCCTACGGGCCGGAGCTCCAA
GCCAATGTCACTGCAGGGCCAGCCGAGGGGTCCCCAGGCTCACCAAGAAATGTCCTTGTCACCAAATCTG
CCTCTGAGCTGACCCTTCAGTGGACAGAGGGAAATGCTGGTACCACACCCACTACAGGCTACGTCATAGA
AGCCAGGCCATCAGATGAAGGCTTATGGGACATGTTTGCAAAGGACAT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 72727. Forward Primer - name:072727_F_cDNA_Sdk1, sequence:AAAATGAAGGTCCTCTTCCTCC; Reverse Primer - name:072727_N_SP6_cDNA_Sdk1, sequence:ATGTCCTTTGCAAACATGTCC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:19980 same embryo
 EMAGE:19981 same embryo
 EMAGE:19979 same embryo
 EMAGE:19978 same embryo
 EurExpress:euxassay_009453 same experiment
 MGI:4827924 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS