Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20027

Slc7a1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 ( MGI:88117)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20027 EMAGE:20027 EMAGE:20027 EMAGE:20027 EMAGE:20027
"Pseudo-wholemount" of euxassay_012248. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012248_01 euxassay_012248_02 euxassay_012248_03 euxassay_012248_04
EMAGE:20027 EMAGE:20027 EMAGE:20027 EMAGE:20027 EMAGE:20027
euxassay_012248_05 euxassay_012248_06 euxassay_012248_07 euxassay_012248_08 euxassay_012248_09
EMAGE:20027 EMAGE:20027 EMAGE:20027 EMAGE:20027 EMAGE:20027
euxassay_012248_10 euxassay_012248_11 euxassay_012248_12 euxassay_012248_13 euxassay_012248_14
EMAGE:20027 EMAGE:20027 EMAGE:20027 EMAGE:20027 EMAGE:20027
euxassay_012248_15 euxassay_012248_16 euxassay_012248_17 euxassay_012248_18 euxassay_012248_19
EMAGE:20027 EMAGE:20027 EMAGE:20027 EMAGE:20027 EMAGE:20027
euxassay_012248_20 euxassay_012248_21 euxassay_012248_22 euxassay_012248_23 euxassay_012248_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20027Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20027_wholemount_strong.wlz
20027_wholemount_moderate.wlz
20027_wholemount_weak.wlz
20027_wholemount_possible.wlz
20027_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20027_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
adrenal gland
moderate moderate
regionalmoderate expression: see section 07 08 09 10 weak expression: see section 16 17 18
submandibular gland primordium
weak weak
regionalweak expression: see section 08 09 10 16 17 18 19
vibrissa
moderate moderate
regionalmoderate expression: see section 05 06 20 21 22
diencephalon lateral wall mantle layer
strong strong
spottedstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
diencephalon meninges
strong strong
regionalstrong expression: see section 08 09 10 11 13 14 15 16 17 18 19 20
telencephalon mantle layer
strong strong
spottedstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
telencephalon meninges
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate mantle layer
strong strong
spottedstrong expression: see section 08 09 10 11 12 13 14 15 17 18 19 20
medulla oblongata basal plate mantle layer
strong strong
spottedstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19
hindbrain meninges
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
rest of cerebellum mantle layer
strong strong
spottedstrong expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
pons mantle layer
strong strong
spottedstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
midbrain meninges
strong strong
regionalstrong expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
midbrain mantle layer
strong strong
spottedstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20 21
spinal cord mantle layer
strong strong
spottedstrong expression: see section 10 11 12 13 14 15 16 17
spinal cord meninges
strong strong
regionalstrong expression: see section 10 11 12 15 16 17 moderate expression: see section 13 14
mandible
weak weak
regionalweak expression: see section 04 05 22 23 24
lower jaw incisor
weak weak
regionalweak expression: see section 11 12 15
lower jaw molar
weak weak
regionalweak expression: see section 07 18 20
upper jaw incisor
weak weak
regionalweak expression: see section 11 15 16
upper jaw molar
weak weak
regionalweak expression: see section 07 09 18 20
temporal bone
weak weak
regionalweak expression: see section 04 05 06 21 22 23
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 22 weak expression: see section 05 06 19 21 23
viscerocranium
weak weak
regionalExpression in the turbinate bone.
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37042
Entity Detected:Slc7a1, solute carrier family 7 (cationic amino acid transporter, y+ system), member 1 ( MGI:88117)
Sequence:sense strand is shown

>T37042
GATCAGAATGAGCTGGTCAGTGCCAGTGAATCACAGACAGGCTTTTTACCGGTAGCCGAGAAGTTTTCTC
TGAAATCCATCCTCTCACCCAAGAACGTGGAGCCCTCCAAATTCTCAGGGCTAATTGTGAACATTTCAGC
CGGCCTCCTAGCCGCTCTTATCATCACCGTGTGCATTGTGGCCGTGCTTGGAAGAGAGGCCCTGGCCGAA
GGGACACTGTGGGCAGTCTTTGTAATGACAGGGTCAGTCCTCCTCTGCATGCTGGTGACAGGCATCATCT
GGAGACAGCCTGAGAGCAAGACCAAGCTCTCATTTAAGGTACCCTTTGTCCCCGTACTTCCTGTCTTGAG
CATCTTCGTGAACATCTATCTCATGATGCAGCTGGACCAGGGCACGTGGGTCCGGTTTGCAGTGTGGATG
CTGATAGGTTTCACCATCTATTTCGGTTATGGGATCTGGCACAGTGAGGAAGCGTCCCTGGCTGCTGGCC
AGGCAAAGACTCCTGACAGCAACTTGGACCAGTGCAAATGACGTGCAGCCCCACCCACCAGGGTGACAGC
GGTTGACGGGTGCCCGTAGAAGCCTGGGACCCTCACAATCTCTCCACTCATGCCTCAGGATCAGCTCACA
CCCCCAATGTCACCAAAGCTGGTTTGCTGCCAGCTCGTGAGATCCTGGTCATTTCTGGACAGTCCCTTGG
TTTACT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 97389. Forward Primer - name:097389_F_cDNA_Slc7a1, sequence:GATCAGAATGAGCTGGTCAGTG; Reverse Primer - name:097389_N_SP6_cDNA_Slc7a1, sequence:AGTAAACCAAGGGACTGTCCAGA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20028 same embryo
 EMAGE:20031 same embryo
 EMAGE:20030 same embryo
 EMAGE:20029 same embryo
 EMAGE:20032 same embryo
 EurExpress:euxassay_012248 same experiment
 MGI:4828271 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS