Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20043

Nf1 neurofibromatosis 1 ( MGI:97306)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20043 EMAGE:20043 EMAGE:20043 EMAGE:20043 EMAGE:20043
"Pseudo-wholemount" of euxassay_012186. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012186_01 euxassay_012186_02 euxassay_012186_03 euxassay_012186_04
EMAGE:20043 EMAGE:20043 EMAGE:20043 EMAGE:20043 EMAGE:20043
euxassay_012186_05 euxassay_012186_06 euxassay_012186_07 euxassay_012186_08 euxassay_012186_09
EMAGE:20043 EMAGE:20043 EMAGE:20043 EMAGE:20043 EMAGE:20043
euxassay_012186_10 euxassay_012186_11 euxassay_012186_12 euxassay_012186_13 euxassay_012186_14
EMAGE:20043 EMAGE:20043 EMAGE:20043 EMAGE:20043 EMAGE:20043
euxassay_012186_15 euxassay_012186_16 euxassay_012186_17 euxassay_012186_18 euxassay_012186_19
EMAGE:20043 EMAGE:20043 EMAGE:20043 EMAGE:20043
euxassay_012186_20 euxassay_012186_21 euxassay_012186_22 euxassay_012186_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20043Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20043_wholemount_strong.wlz
20043_wholemount_moderate.wlz
20043_wholemount_weak.wlz
20043_wholemount_possible.wlz
20043_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20043_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 21
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 18
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 17 18 19 20 21 22
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 07 08 17
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 07 11 12 13 14 15 17 weak expression: see section 08 09 10 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36681
Entity Detected:Nf1, neurofibromatosis 1 ( MGI:97306)
Sequence:sense strand is shown

>T36681
TACAGCCCTGGGAAAAGTAAGAACCATTTGCCAAAATAAAAGGAAACCCCTTAGTGTTAGTAGTGATTTT
AACATAGAATCACTGGAGACTACTGGAGACAGATGCAGCAAACTGAGCTCTTGTAAAGGCTGCCTTAGAA
TAACTGTCAGAGCAGATAACCAAGGCTGGGAGGCTGAGATGCCAGCTGAGTTTAGCCGCAGGAGGCCCGT
GGCTTAGCTGCCAGGCCCGGCTCCCCACCGCAGTACTGCTGGGGTGCACCCCGCTCTGGCTCCTGCAACC
GTGGGCAGCACAGACTGAGGCTGCTGTAACTCTAGTTGCTTGGCTTTTTTAAAGTCATTGAGTTCCATTA
CTGGCCCATTACTGTTTTGCTTCCCCCATCAAAACAGGACAACTTATAAATGTGCACTCTTCCTGTAGCG
GGTTTCCCCATAGTTCTTAAACTGCCCCACTTGAGCTCCTATGGAAAGATCAAACGGAGCCACTTCTGAC
CAGTACATCCCAGGAAACTGGGGCAGCATTCCAGTTTTATCTAATAGACAGAACTTCCAGCTTTTGAGGA
AAGTCTATCTTTGCAAGCAACTGAACCTACAGAGCTTAA
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 63890. Forward Primer - name:063890_F_cDNA_Nf1, sequence:TACAGCCCTGGGAAAAGTAAGA; Reverse Primer - name:063890_N_SP6_cDNA_Nf1, sequence:TTAAGCTCTGTAGGTTCAGTTGC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20048 same embryo
 EMAGE:20046 same embryo
 EMAGE:20044 same embryo
 EMAGE:20047 same embryo
 EMAGE:20045 same embryo
 EurExpress:euxassay_012186 same experiment
 MGI:4826681 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS