Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20044

Spna2 spectrin alpha 2 ( MGI:98386)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20044 EMAGE:20044 EMAGE:20044 EMAGE:20044 EMAGE:20044
"Pseudo-wholemount" of euxassay_012194. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012194_01 euxassay_012194_02 euxassay_012194_03 euxassay_012194_04
EMAGE:20044 EMAGE:20044 EMAGE:20044 EMAGE:20044 EMAGE:20044
euxassay_012194_05 euxassay_012194_06 euxassay_012194_07 euxassay_012194_08 euxassay_012194_09
EMAGE:20044 EMAGE:20044 EMAGE:20044 EMAGE:20044 EMAGE:20044
euxassay_012194_10 euxassay_012194_11 euxassay_012194_12 euxassay_012194_13 euxassay_012194_14
EMAGE:20044 EMAGE:20044 EMAGE:20044 EMAGE:20044 EMAGE:20044
euxassay_012194_15 euxassay_012194_16 euxassay_012194_17 euxassay_012194_18 euxassay_012194_19
EMAGE:20044 EMAGE:20044 EMAGE:20044 EMAGE:20044 EMAGE:20044
euxassay_012194_20 euxassay_012194_21 euxassay_012194_22 euxassay_012194_23 euxassay_012194_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20044Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20044_wholemount_strong.wlz
20044_wholemount_moderate.wlz
20044_wholemount_weak.wlz
20044_wholemount_possible.wlz
20044_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20044_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23 24
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 19 20 21 22
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 07 08 18 19
trigeminal v ganglion
strong strong
regionalstrong expression: see section 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
strong strong
regionalstrong expression: see section 08
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 07 08 09 18 19
trigeminal v nerve
strong strong
regionalstrong expression: see section 09 10 17 18
spinal cord
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
ventral grey horn
strong strong
regionalstrong expression: see section 10 11 12 13 14 15 16 17 18 19
cervico-thoracic ganglion
strong strong
regionalstrong expression: see section 10 14 16
cervical ganglion
strong strong
regionalstrong expression: see section 09 17
thoracic ganglion
strong strong
regionalstrong expression: see section 11 13 14 15
dorsal root ganglion
strong strong
spottedstrong expression: see section 08 09 10 11 12 13 14 15 16 17 18 19 20
lens
strong strong
regionalstrong expression: see section 01 02
neural retina
strong strong
regionalstrong expression: see section 02 03 04 23 24
tongue
strong strong
spottedstrong expression: see section 12 14
stomach
strong strong
spottedstrong expression: see section 09 10 11 moderate expression: see section 05 06 07 08
midgut
strong strong
spottedstrong expression: see section 13 14 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T37073
Entity Detected:Spna2, spectrin alpha 2 ( MGI:98386)
Sequence:sense strand is shown

>T37073
AGTGAGCTCTGAGGACTATGGCAGAGACCTCACTGGTGTTCAGAATCTGAGGAAGAAACACAAGCGGCTA
GAAGCTGAACTGGCTGCACATGAACCCGCCATTCAGGGTGTCCTGGACACTGGGAAGAAGCTGTCTGATG
ACAACACCATCGGGCAGGAGGAGATCCAGCAACGGCTTGCACAGTTTGTGGAGCACTGGAAGGAACTAAA
GCAGCTGGCGGCTGCGCGGGGCCAGCGGCTAGAGGAGTCCTTGGAGTATCAGCAGTTTGTAGCCAACGTG
GAAGAGGAGGAGGCTTGGATCAATGAGAAGATGACTCTGGTGGCCAGCGAAGACTATGGAGACACTCTTG
C
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 76402. Forward Primer - name:076402_F_cDNA_Spna2, sequence:AGTGAGCTCTGAGGACTATGGC; Reverse Primer - name:076402_N_SP6_cDNA_Spna2, sequence:GCAAGAGTGTCTCCATAGTCTTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20048 same embryo
 EMAGE:20046 same embryo
 EMAGE:20043 same embryo
 EMAGE:20047 same embryo
 EMAGE:20045 same embryo
 EurExpress:euxassay_012194 same experiment
 MGI:4828417 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS