Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20048

Mpdz multiple PDZ domain protein ( MGI:1343489)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20048 EMAGE:20048 EMAGE:20048 EMAGE:20048 EMAGE:20048
"Pseudo-wholemount" of euxassay_012184. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012184_01 euxassay_012184_02 euxassay_012184_03 euxassay_012184_04
EMAGE:20048 EMAGE:20048 EMAGE:20048 EMAGE:20048 EMAGE:20048
euxassay_012184_05 euxassay_012184_06 euxassay_012184_07 euxassay_012184_08 euxassay_012184_09
EMAGE:20048 EMAGE:20048 EMAGE:20048 EMAGE:20048 EMAGE:20048
euxassay_012184_10 euxassay_012184_11 euxassay_012184_12 euxassay_012184_13 euxassay_012184_14
EMAGE:20048 EMAGE:20048 EMAGE:20048 EMAGE:20048 EMAGE:20048
euxassay_012184_15 euxassay_012184_16 euxassay_012184_17 euxassay_012184_18 euxassay_012184_19
EMAGE:20048 EMAGE:20048 EMAGE:20048 EMAGE:20048 EMAGE:20048
euxassay_012184_20 euxassay_012184_21 euxassay_012184_22 euxassay_012184_23 euxassay_012184_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20048Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20048_wholemount_strong.wlz
20048_wholemount_moderate.wlz
20048_wholemount_weak.wlz
20048_wholemount_possible.wlz
20048_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20048_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall marginal layer
moderate moderate
regionalmoderate expression: see section 12 13 14 15
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 12 13 14 15
telencephalon marginal layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 15 16 17 18 19 20 21 22 23 24
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
medulla oblongata alar plate marginal layer
moderate moderate
regionalmoderate expression: see section 07 08
medulla oblongata alar plate ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
medulla oblongata basal plate ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14
rest of cerebellum marginal layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 14 15 16 17 18 19 20 21 22
rest of cerebellum ventricular layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22
pons ventricular layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain marginal layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 14 15 16 17 18 19
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16 17 18
spinal cord ventricular layer
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17
neural retina
moderate moderate
regionalmoderate expression: see section 02 03 23 24
nasal cavity olfactory epithelium
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 14 15 16 17 18
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T36641
Entity Detected:Mpdz, multiple PDZ domain protein ( MGI:1343489)
Sequence:sense strand is shown

>T36641
GATCAAGGAGGTTTAGGCATTGCTATCTGTGAGGAAGACACAATCAACGGAGTCATGATCGAAAGCCTAA
CTGAGCACGGGGGAGCAGCCAAGGATGGAAGGCTCAAACCTGGAGATCACATCTTGGCTGTAGATGATGA
AGTTGTTGCTGGGTGTCCTGTTGAAAAGTTCATCAGCCTTCTGAAGACGGCAAAGGCAACTGTAAAACTG
ACTGTTCGAGCTGAGAATCCAGCTTGTCCAGCTGTTCCTTCTTCAGCTGTAACAGTCAGTGGAGAAAGGA
AAGACAACTCCCAGACTCCTGCAGTCCCAGCTCCAGACCTGGAACCCATCCCAAGTCCAAGCAGGTCCTC
CACACCAGCAGTCTTTGCTTCTGACCCTGCCACCTGCCCCATCATCCCAGGCTGTGAGACAACAATTGAG
ATTTCCAAAGGCCAAACAGGCCTGGGACTGAGTATTGTTGGGGGCTCAGACACACTGCTGGGTGCTATTA
TTATCCATGAAGTTTATGAAGAGGGAGCAGCGTGTAAAGATGGAAGACTATGGGCTGGAGACCAGATTTT
AGAGGTAAATGGGATTGACTTGCGAAAGGCTACACATGATGAAGCAATCAATGTCCTGAGGCAGACGCCT
CAAAGAGTACGGCTGACGCTCTACCGAGATGAGGCCCCATACAAAGAGGAGGATGTCTGTGATACCTTCA
CCATCGAGCTGCAGAAGAGGCCAGGCAAAGGCCTTGGGTTGAGTATTGTTGGCAAAAGAAATGACACTGG
AGTATTTGTATCAGACATTGTCAAGGGAGGCATTGCAGACGCCGATGGGAGACTGATGCAAGGGGACCAG
ATTTTAATGGTGAATGGAGAAGATGTCCGTCATGCCAC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 100894. Forward Primer - name:100894_F_cDNA_Mpdz, sequence:GATCAAGGAGGTTTAGGCATTG; Reverse Primer - name:100894_N_SP6_cDNA_Mpdz, sequence:GTGGCATGACGGACATCTTCT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20046 same embryo
 EMAGE:20043 same embryo
 EMAGE:20044 same embryo
 EMAGE:20047 same embryo
 EMAGE:20045 same embryo
 EurExpress:euxassay_012184 same experiment
 MGI:4826426 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS