Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20137

Gtf3c2 general transcription factor IIIC, polypeptide 2, beta ( MGI:1919002)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20137 EMAGE:20137 EMAGE:20137 EMAGE:20137 EMAGE:20137
"Pseudo-wholemount" of euxassay_012454. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012454_01 euxassay_012454_02 euxassay_012454_03 euxassay_012454_04
EMAGE:20137 EMAGE:20137 EMAGE:20137 EMAGE:20137 EMAGE:20137
euxassay_012454_05 euxassay_012454_06 euxassay_012454_07 euxassay_012454_08 euxassay_012454_09
EMAGE:20137 EMAGE:20137 EMAGE:20137 EMAGE:20137 EMAGE:20137
euxassay_012454_10 euxassay_012454_11 euxassay_012454_12 euxassay_012454_13 euxassay_012454_14
EMAGE:20137 EMAGE:20137 EMAGE:20137 EMAGE:20137 EMAGE:20137
euxassay_012454_15 euxassay_012454_16 euxassay_012454_17 euxassay_012454_18 euxassay_012454_19
EMAGE:20137 EMAGE:20137 EMAGE:20137 EMAGE:20137 EMAGE:20137
euxassay_012454_20 euxassay_012454_21 euxassay_012454_22 euxassay_012454_23 euxassay_012454_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20137Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20137_wholemount_strong.wlz
20137_wholemount_moderate.wlz
20137_wholemount_weak.wlz
20137_wholemount_possible.wlz
20137_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20137_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
thymus primordium
weak weak
regionalweak expression: see section 09 10 11 12 13
submandibular gland primordium
weak weak
regionalweak expression: see section 05 06 07 15 16 17
vibrissa
weak weak
regionalweak expression: see section 04 05 17 18 19
hypothalamus ventricular layer
weak weak
regionalweak expression: see section 11 12 13 14
diencephalon lateral wall ventricular layer
weak weak
regionalweak expression: see section 12 13 14 15
olfactory cortex ventricular layer
moderate moderate
homogeneousmoderate expression: see section 10 15
telencephalon ventricular layer
moderate moderate
homogeneousmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
neural retina
weak weak
regionalweak expression: see section 01 02 21 22 23 24
nasal cavity olfactory epithelium
weak weak
regionalweak expression: see section 09 10 11 13 14 15 16 17
vomeronasal organ
weak weak
regionalweak expression: see section 10
lower jaw incisor
weak weak
regionalweak expression: see section 08 09 11 12
lower jaw molar
weak weak
regionalweak expression: see section 05 17
upper jaw incisor
weak weak
regionalweak expression: see section 08 09 12 13
upper jaw molar
weak weak
regionalweak expression: see section 05 17 18
metanephros
weak weak
regionalweak expression: see section 06 07 08 09 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T31326
Entity Detected:Gtf3c2, general transcription factor IIIC, polypeptide 2, beta ( MGI:1919002)
Sequence:sense strand is shown

>T31326
TTCTTCACAGGGGGACCACTCTGGGCTCTGGACTGGTGCCCAGTGCCTGAAGGGTCAGCAGCTTCACAGT
ATGTGGCCCTTTTCTCCAGCCCTGACATGAATGAGACACACCCACTGAGCCAGCTTCATTCAGGCCCTGG
GCTGCTGCAGCTCTGGGGTCTTGGGACATTGCAGCAAGAAAGCTGTCCTGGCAATAGGGCCCACTTTGTC
TATGGGATTGCTTGTGACAGTGGCTGTATCTGGGACCTCAAGTTCTGCCCCAGTGGGGCATGGGAACATC
CAGAAACCCTTCGGAAGGCTCCTCTCCTGCCTCGCCTGGGTCTCTTGGCTCTGGCCTGCTCAGATGGGAA
GGTACTGCTCTTCAGCCTGCCGCATCCTGAGGCCCTCCTGGCACAGCAGCCTCCAGATGCTATGAAGCCT
GCCATCTACAAGGTCCAGTGTTTGGCAACTCTTCAGGTAGGGTCTGTGCAAGCTTCAGACCCCTCTGAGT
GTGGTCAGTGCCTTAGCCTGGCTTGGATGCCTACCAGACCTCACCACCACCTGGCTGCTGGGTACTATAA
TGGCATGGTAGTTTTCTGGAATCTTCCCACTAACTCACCCCTCCAAAGGATACGGCTCTCTGATGGCTCC
TTAAAGCTCTATCCCTTCCAGTGTTTCCTAGCCCATGACCAGGCTGTCCGTACAATTCAGTGGTGCAAAG
CTAACAGTCATTTCCTGGTGTCTGCGGGGAGTGACCGGAAAATCAAATTCTGGGATCTTCGACGACCTTA
TGAACCAATAAACTGTATCAAGCGCTTCTTGAGTACAGAGCTTTCCTGGCTGCTCCCCTATAATGGTGTC
ACAGTGGCTCAAGACAACTGTTATGCCTCTTACGGGCTCTGTGGAATTCATTACATTGATGCCGGTTACC
TCGGTTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from the plasmid IMAGE:3994677), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 22161. Forward Primer - name:022161_F_IRAV51-54_H24_Gtf3c2, sequence:TTCTTCACAGGGGGACCA; Reverse Primer - name:022161_R_SP6_IRAV51-54_H24_Gtf3c2, sequence:AAAACCGAGGTAACCGGC. The reverse primer contains a 5' extension containing an SP6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using SP6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20136 same embryo
 EMAGE:20135 same embryo
 EMAGE:20138 same embryo
 EurExpress:euxassay_012454 same experiment
 MGI:4825281 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS