Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:20713

Csmd3 CUB and Sushi multiple domains 3 ( MGI:2386403)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:20713 EMAGE:20713 EMAGE:20713 EMAGE:20713 EMAGE:20713
"Pseudo-wholemount" of euxassay_013996. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013996_01 euxassay_013996_02 euxassay_013996_03 euxassay_013996_04
EMAGE:20713 EMAGE:20713 EMAGE:20713 EMAGE:20713 EMAGE:20713
euxassay_013996_05 euxassay_013996_06 euxassay_013996_07 euxassay_013996_08 euxassay_013996_09
EMAGE:20713 EMAGE:20713 EMAGE:20713 EMAGE:20713 EMAGE:20713
euxassay_013996_10 euxassay_013996_11 euxassay_013996_12 euxassay_013996_13 euxassay_013996_14
EMAGE:20713 EMAGE:20713 EMAGE:20713 EMAGE:20713 EMAGE:20713
euxassay_013996_15 euxassay_013996_16 euxassay_013996_17 euxassay_013996_18 euxassay_013996_19
EMAGE:20713 EMAGE:20713 EMAGE:20713 EMAGE:20713
euxassay_013996_20 euxassay_013996_21 euxassay_013996_22 euxassay_013996_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:20713Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
20713_wholemount_strong.wlz
20713_wholemount_moderate.wlz
20713_wholemount_weak.wlz
20713_wholemount_possible.wlz
20713_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:20713_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 15 16 17 weak expression: see section 12
telencephalon mantle layer
moderate moderate
regionalmoderate expression: see section 04 05 06 07 09 10 11 13 14 15 16 17 18 19 20 21 weak expression: see section 08 12
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 15 17 18 19 weak expression: see section 12 16
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 15 17 18 19 weak expression: see section 08 16
pons mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 09 10 11 13 14 15 17 18 19 weak expression: see section 08 12 16
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 09 13 14 15 16 17 18
tegmentum
moderate moderate
regionalmoderate expression: see section 10 11 12
heart ventricle
strong strong
spottedstrong expression: see section 08 09 10 11 moderate expression: see section 07 12 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39579
Entity Detected:Csmd3, CUB and Sushi multiple domains 3 ( MGI:2386403)
Sequence:sense strand is shown

>T39579
CCTGCTCATGCAAACGTAGTAGGAATGGACCTTCCCTCCCATGGGTACACACTCATCTATACATGTCAGC
CTGGCTTCTTCTTAGCAGGGGGAACTGAGCATAGAGTATGCAGATCTGATAATACCTGGACTGGAAAAGT
TCCTGTCTGTGAAGCTGGTTCCAAAATATTAGTGAAAGATCCTCGACCTGCATTAGGAACACCTAGTCCG
AAGCTAAGTGTTCCTGATGATGTGTTTGCCCAGAATTATATATGGAAAGGCTCTTATAATTTCAAAGGAA
GGAAACAGCCCATGACCTTGACAGTCACTAGCTTCAATGCCTCTACTGGCAGAGTCAATGCGACACTGAG
CAACAGCGACATGGAGTTGCTGCTTTCAGGGGTCTACAAAAGCCAGGAAGCCCGCCTAATGTTACATATA
TATCTTATTAAAGTGCCAGCACATGCTTCTGTGAAGAAAATGAAGGAAGAAAATTGGGCCATGGATGGAT
TTGTTTCTGCTGAGCCTGATGGAGCTACTTATGTATTCCAAGGATTTATTAAAGGCAAAGATTATGGGCA
ATTTGGACTACAAAGACTAGGACTGAATACTTCAGAAGGGTCAAATTCTTCAAATCAGCCTCATGGTACA
AATAGCAGTTCTGTGGCCATTGCGATACTTGTGCCTTTTTTTGCACTTATATTTGCAGGATTTGGGTTTT
ATCTTTACAAACAAAGGACTGCACCCAAAACACAGTACACAGGATGTTCTGTTCATGAAAATAACAATGG
CCAAGCAGCCTTTGAGAACCCCATGTATGACACCAATGCCAAGTCTGTGGAGGGGAAGGCAGTACGATTC
GACCCCAACTTGAACACAGTTT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 85021. Forward Primer - name:085021_F_cDNA_Csmd3, sequence:CCTGCTCATGCAAACGTAGTAG; Reverse Primer - name:085021_N_SP6_cDNA_Csmd3, sequence:AAACTGTGTTCAAGTTGGGGTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:20712 same embryo
 EurExpress:euxassay_013996 same experiment
 MGI:4824081 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS