Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:3739

Sorbs3 sorbin and SH3 domain containing 3 ( MGI:700013)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:3739 EMAGE:3739 EMAGE:3739 EMAGE:3739
Figure 3A. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00421-X] Mech Dev 106: 147-50, Kawauchi T; Ikeya M; Takada S; Ueda K; Shirai M; Takihara Y; Kioka N; Amachi T, Expression of vinexin alpha in the dorsal half of the eye and in the cardiac outflow tract and atrioventricular canal. Copyright 2001. Figure 3B. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00421-X] Mech Dev 106: 147-50, Kawauchi T; Ikeya M; Takada S; Ueda K; Shirai M; Takihara Y; Kioka N; Amachi T, Expression of vinexin alpha in the dorsal half of the eye and in the cardiac outflow tract and atrioventricular canal. Copyright 2001. Figure 3C. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00421-X] Mech Dev 106: 147-50, Kawauchi T; Ikeya M; Takada S; Ueda K; Shirai M; Takihara Y; Kioka N; Amachi T, Expression of vinexin alpha in the dorsal half of the eye and in the cardiac outflow tract and atrioventricular canal. Copyright 2001. Figure 3D. Copyright: Reprinted with permission from Elsevier from [doi:10.1016/S0925-4773(01)00421-X] Mech Dev 106: 147-50, Kawauchi T; Ikeya M; Takada S; Ueda K; Shirai M; Takihara Y; Kioka N; Amachi T, Expression of vinexin alpha in the dorsal half of the eye and in the cardiac outflow tract and atrioventricular canal. Copyright 2001.

Expression pattern clarity: three stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Notes:
Note: The lines in B show the orientation of the sections in C and D. OFT= outflow tract; LV= left ventricle; A= atrium; AV= atrioventricular canal.
Expression Pattern Description
Spatial Annotation:
EMAGE:3739Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
3739_wholemount_strong_3D_1.wlz
3739_wholemount_moderate_3D_1.wlz
3739_wholemount_notDetected_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:3739_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
outflow tract
strong strong
Expression is strong in the endothelial cells, but weak in the mesenchymal cells.
atrioventricular canal
moderate moderate
Expression is strong in the endothelial cells, but weak in the mesenchymal cells.
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:MGI:2183784
Entity Detected:Sorbs3, sorbin and SH3 domain containing 3 ( MGI:700013)
Sequence:sense strand is shown

>MGI:2183784
GTGAAGGGGGATGGCCAGGATTCTTGGAGTGGGAAGATCTTCAGCTTCGTCTTTGAACAACAAAGAAGAC
AATGAAAGTGATGTAGCCCTTCTTAGTCCCAAGGACCCTAACAGAGTACACACGAAGGAGCAGCTGGCAC
ATCCTGCGTCCTCCAACCTTGACCCAAGCATGCAAGGCCTCCCTGCTGGGCTCAGCCTGGATGATTTCAT
CCCTGGTCACCTCCGAACCCATATAGGCTCATCCTCCCGGGGGACAAGGGTGCCAGTGATCCGGAATGGT
GGCTCCAACACCCTTAATTTCCAGTTTCATGACCCTGCGCCCAGGACTGTGTGCAATGGCTGCCCCCCAC
CCAGGAGAGATGGTTCCTTGAATCCAGACCCAGCATGGTATCAGACCTGGCCAGGCCCTGGGAGCCGGCC
CTCTATGAGCCCGAAGCCACCTGCTTCCCAGCATGCCCAGAACTGGTCAGCCACATGGACCAAGGACAGC
AAGCGACAGGACAAGCGCTGGGTGAAGTACGAGGGAATCGGGCCCGTGGATGAGAGCGGCATGCCCATTG
CCCCCCGATCTAGTGTTGACAGCCCCAGAGACTGGTATCGAAGAATGTTCCAGCAAATTCACCGGAAAAT
GCCAGACCTGCAGCTGGACTGGACCTTGGAAGACCCACCCAAAGTGGTTTCCGCACGCGCCTCTTCTGCA
GAACCCAGGCATCTAGGGACCCTGCAAAGACCTGCCTCCAGGCCTGGCACAACTGAGACTTCTAGCGGAA
GAAACTGGAACCACTCTGAAGAGACAT
nt 1 - nt 797 of AF064806.1
Notes:The Sorbs3 (vinexin) probe used in this study by Kawauchi et al., 2001 [PMID:11472845] was described as a "812 bp EcoRI-XbaI fragment of N-terminus of mouse vinexin a cDNA (Kioka et al., 1999 [PMID:9885244] , AF064806.1)". This probe is specific to the alpha isoform. Editors Note: XbaI cuts AF064806.1 at position 797 whereas EcoRI does not cut AF064806.1, therefore the EcoRI site is presumed to be in the multiple cloning site at the 5' end of the insert.
Chemistry:RNA
Strand:antisense
Specimen
Organism:mouse
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:sectioned wholemount
Procedures
Fixation:4% paraformaldehyde
Embedding:cryosection
General Information
Authors:Kawauchi T; Ikeya M; Takada S; Ueda K; Shirai M; Takihara Y; Kioka N; Amachi T, 2001 [PMID:11472845] . Indexed by GXD, Spatially mapped by EMAGE.
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:non-screen
References:[ doi:10.1016/S0925-4773(01)00421-X] [ PMID:11472845] Kawauchi T, Ikeya M, Takada S, Ueda K, Shirai M, Takihara Y, Kioka N, Amachi T 2001 Expression of vinexin alpha in the dorsal half of the eye and in the cardiac Mech Dev (106):147-50
 [ doi:10.1083/jcb.144.1.59] [ PMID:9885244] Kioka N, Sakata S, Kawauchi T, Amachi T, Akiyama SK, Okazaki K, Yaen C, Yamada KM, Aota S 1999 Vinexin: a novel vinculin-binding protein with multiple SH3 domains enhances actin cytoskeletal organization. J Cell Biol (144):59-69
Links:MGI:2183832 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceMGI