Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6098

Tmc5 transmembrane channel-like gene family 5 ( MGI:1921674)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6098 EMAGE:6098 EMAGE:6098 EMAGE:6098 EMAGE:6098
"Pseudo-wholemount" of euxassay_008628. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_008628_01 euxassay_008628_02 euxassay_008628_03 euxassay_008628_04
EMAGE:6098 EMAGE:6098 EMAGE:6098 EMAGE:6098 EMAGE:6098
euxassay_008628_05 euxassay_008628_06 euxassay_008628_07 euxassay_008628_08 euxassay_008628_09
EMAGE:6098 EMAGE:6098 EMAGE:6098 EMAGE:6098 EMAGE:6098
euxassay_008628_10 euxassay_008628_11 euxassay_008628_12 euxassay_008628_13 euxassay_008628_14
EMAGE:6098 EMAGE:6098 EMAGE:6098 EMAGE:6098 EMAGE:6098
euxassay_008628_15 euxassay_008628_16 euxassay_008628_17 euxassay_008628_18 euxassay_008628_19
EMAGE:6098 EMAGE:6098 EMAGE:6098 EMAGE:6098
euxassay_008628_20 euxassay_008628_21 euxassay_008628_22 euxassay_008628_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6098Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6098_wholemount_strong.wlz
6098_wholemount_moderate.wlz
6098_wholemount_weak.wlz
6098_wholemount_possible.wlz
6098_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6098_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: three stars
Text Annotation:
StructureLevelPatternNotes
rib
moderate moderate
regionalmoderate expression: see section 03 07 08 09 13 14 15 16 17 18 19 20 21 weak expression: see section 01 02 04 05 06 22
radius
moderate moderate
regionalmoderate expression: see section 01 19 20 21 23
ulna
moderate moderate
regionalmoderate expression: see section 01 23
humerus
moderate moderate
regionalmoderate expression: see section 01 02 03 04 19 20 21 22 23
forelimb digit 1 metacarpal
moderate moderate
regionalmoderate expression: see section 22
forelimb digit 1 phalanx
moderate moderate
regionalmoderate expression: see section 21 22
forelimb digit 2 metacarpal
moderate moderate
regionalmoderate expression: see section 22
forelimb digit 2 phalanx
moderate moderate
regionalmoderate expression: see section 22
fibula
moderate moderate
regionalmoderate expression: see section 17 18 19 20
tibia
moderate moderate
regionalmoderate expression: see section 17 18 19 20
femur
moderate moderate
regionalmoderate expression: see section 01 02 16 17 18 19 20
nasal septum
moderate moderate
regionalmoderate expression: see section 11
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21
axial skeleton
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
basioccipital bone
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
basisphenoid bone
moderate moderate
regionalmoderate expression: see section 08 09 10 11 12 13 14 15 16
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 01 02 18 19 20 21 22 23
orbito-sphenoid
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 17 18 19 20 21 22 23
scapula
moderate moderate
regionalmoderate expression: see section 02 03 04 22
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 05 06 11 12
Annotation Validation: EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:T2782
Entity Detected:Tmc5, transmembrane channel-like gene family 5 ( MGI:1921674)
Sequence:sense strand is shown

>T2782
AATTCGNNACGAGGGGCCTGGCTACCTGTGGGTCGTCTGGATCTACCAGAATCTCATTGGAAGTGTGCAC
TTCTTCTTCATCCTCACCCTCATTGTGCTAATCATCACCTATCTTTACTGGCAGATCACAGAGGGGAGGA
AGGTCATGATTCGATTGCTCCATGAACAGATCATTAATGAGGGCAAAGATAAGATGTTCCTGATAGAGAA
ATTGACCAAACTACAGGATATGGAGAAGAGAGTCAACCCCAGTGCCCTTGACCTGGAAAGGAGAGAGGTG
GAGCCACAAATTCCTTTGCATTTGGAGGAACTTGGTGCTGCTCCTGACCTGCGATTGAGGCGGTCAGCAC
AAGAGGAGAATCCCATAGCCTGATCACTGTTGTGTGTTGTGGAAGCAAGATGCTGGTCAAAGGGAAAAGA
AGGTACATATGAGACCACCTCCGTGACAGATGGGCCTCAGGAGCTTCTCGGGAGTGGAATCCAAGCCCGA
GGAATCGGATCCGCAGTGCGAACAGCTCCATGAAAGAGGGCATGCCTTATTTCCAACCTGGACTGCTGA
Notes:The probe template was PCR amplified from IMAGE:1515194 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:1515194 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:BL6/SV129
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:MGI:4828754 same experiment
 EurExpress:euxassay_008628 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS