Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6216

Olfr653 olfactory receptor 653 ( MGI:3030487)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6216 EMAGE:6216 EMAGE:6216 EMAGE:6216 EMAGE:6216
"Pseudo-wholemount" of euxassay_013072. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_013072_01 euxassay_013072_02 euxassay_013072_03 euxassay_013072_04
EMAGE:6216 EMAGE:6216 EMAGE:6216 EMAGE:6216 EMAGE:6216
euxassay_013072_05 euxassay_013072_06 euxassay_013072_07 euxassay_013072_08 euxassay_013072_09
EMAGE:6216 EMAGE:6216 EMAGE:6216 EMAGE:6216 EMAGE:6216
euxassay_013072_10 euxassay_013072_11 euxassay_013072_12 euxassay_013072_13 euxassay_013072_14
EMAGE:6216 EMAGE:6216 EMAGE:6216 EMAGE:6216 EMAGE:6216
euxassay_013072_15 euxassay_013072_16 euxassay_013072_17 euxassay_013072_18 euxassay_013072_19
EMAGE:6216 EMAGE:6216 EMAGE:6216 EMAGE:6216 EMAGE:6216
euxassay_013072_20 euxassay_013072_21 euxassay_013072_22 euxassay_013072_23 euxassay_013072_24
EMAGE:6216 EMAGE:6216
euxassay_013072_25 euxassay_013072_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6216Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6216_wholemount_strong.wlz
6216_wholemount_moderate.wlz
6216_wholemount_weak.wlz
6216_wholemount_possible.wlz
6216_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6216_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
nasal cavity olfactory epithelium
moderate moderate
single cellmoderate expression: see section 11 12 13 15 16
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39268
Entity Detected:Olfr653, olfactory receptor 653 ( MGI:3030487)
Sequence:sense strand is shown

>T39268
CCTCCCACATTTGTTTTGCTTGGAATCCCTGGGATGCAGGATCAGCATGTTTGGATTGCTATTCCCTTCT
GCTCCATGTACATCCTTGCTCTGGTTGGAAATGGTACCATCCTCTATATCATTATAACAGACAGGGCTCT
CCATGAGCCAATGTACCTCTTCTTGTGTCTGCTTTCTATCACTGATCTGGTTCTCTGTTCAACAACATTG
CCTAAAATGCTGGCAATATTCTGGCTCAGATCCCATGTCATTTCCTACCATGGCTGCCTCACTCAGATGT
TTTTTGTTCATGCAGTCTTTGCCACAGAGTCAGCTGTTCTGCTGGCCATGGCTTTTGATCGATATGTTGC
TATCTGCAGACCACTCCACTATACATCCATCCTCAATGCTGTTGTAATTGGGAAGATTGGCCTGGCATGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 279289. Forward Primer - name:279289_F_cDNA_Olfr653, sequence:CCTCCCACATTTGTTTTGCT; Reverse Primer - name:279289_N_SP6_cDNA_Olfr653, sequence:GCATGCCAGGCCAATCTT. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6217 same embryo
 EMAGE:6219 same embryo
 EMAGE:6220 same embryo
 EMAGE:6218 same embryo
 EMAGE:6221 same embryo
 EurExpress:euxassay_013072 same experiment
 MGI:4826942 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS