Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6705

Lrp12 low density lipoprotein-related protein 12 ( MGI:2443132)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6705 EMAGE:6705 EMAGE:6705 EMAGE:6705 EMAGE:6705
"Pseudo-wholemount" of euxassay_002372. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_002372_01 euxassay_002372_02 euxassay_002372_03 euxassay_002372_04
EMAGE:6705 EMAGE:6705 EMAGE:6705 EMAGE:6705 EMAGE:6705
euxassay_002372_05 euxassay_002372_06 euxassay_002372_07 euxassay_002372_08 euxassay_002372_09
EMAGE:6705 EMAGE:6705 EMAGE:6705 EMAGE:6705 EMAGE:6705
euxassay_002372_10 euxassay_002372_11 euxassay_002372_12 euxassay_002372_13 euxassay_002372_14
EMAGE:6705 EMAGE:6705 EMAGE:6705 EMAGE:6705 EMAGE:6705
euxassay_002372_15 euxassay_002372_16 euxassay_002372_17 euxassay_002372_18 euxassay_002372_19
EMAGE:6705 EMAGE:6705 EMAGE:6705 EMAGE:6705 EMAGE:6705
euxassay_002372_20 euxassay_002372_21 euxassay_002372_22 euxassay_002372_23 euxassay_002372_24
EMAGE:6705
euxassay_002372_25

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6705Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6705_wholemount_strong.wlz
6705_wholemount_moderate.wlz
6705_wholemount_weak.wlz
6705_wholemount_possible.wlz
6705_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6705_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
brain
moderate moderate
homogeneousmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 21 22 23 24 25 weak expression: see section 19 20
trigeminal v ganglion
weak weak
regionalweak expression: see section 02 03 04 05 06 07 16 17 18 19 20 21
spinal cord
moderate moderate
homogeneousmoderate expression: see section 06 07 08 09 10 11 12
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 07 14
cervical ganglion
weak weak
regionalweak expression: see section 07 15
thoracic ganglion
weak weak
regionalweak expression: see section 09 10
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 12 14 weak expression: see section 13
nasal septum
moderate moderate
regionalmoderate expression: see section 12 13 14 15 16 17
viscerocranium
moderate moderate
regionalExpression in the turbinate bone.
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1960
Entity Detected:Lrp12, low density lipoprotein-related protein 12 ( MGI:2443132)
Sequence:sense strand is shown

>T1960
TGGAAGCAGAACTTCTCCGAAGAGAGGCTCCTCCCTCATATGGACAGTTGATCGCTCAGGGACTAATCCC
ACCCGTAGAAGATTTTCCTGTCTGTTCACCTAATCAGGCTTCCGTTTTAGAAAACCTGAGGCTAGCTGTC
CGATCTCAGCTGGGATTTACTTCAATCAGGCTTCCTATGACAGGCAGATCTAGCAACATTTGGAATCGTA
TTTTTAATTTTGCAAGATCCCGTCATTCAGGGTCATTGGCTTTGGTCTCGGGAGATGGAGATGAGGTTGT
CCCTAGCCAGAGCAGCAGCAGAGAAACTGAGAGGAGTCGCCCTCACAGAAGCTTATTCTCCGTGGAGTCC
GATGACACTGACACAGAAAATGAGAGAAGGGATACGGCGGGAGCATCGGGTGGGGTTGCAGCACCGTTGC
CCCAGAAGGTCCCTCCCACGACCGCCGTGGAGGCCACAGTGGGATCAGGTGGGAATTCCTCTGCTCAGAG
CACCAGAGGTGGCCATGCAGATGGAAGGGAAGTGTCAAGTGTG
Notes:The probe template was PCR amplified from IMAGE:640726 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:640726 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6702 same embryo
 EMAGE:6700 same embryo
 EMAGE:6701 same embryo
 EMAGE:6699 same embryo
 EMAGE:6704 same embryo
 EMAGE:6703 same embryo
 EurExpress:euxassay_002372 same experiment
 MGI:4825981 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS