Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6737

Gpr153 G protein-coupled receptor 153 ( MGI:1916157)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:6737 EMAGE:6737 EMAGE:6737 EMAGE:6737 EMAGE:6737
"Pseudo-wholemount" of euxassay_007373. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007373_01 euxassay_007373_02 euxassay_007373_03 euxassay_007373_04
EMAGE:6737 EMAGE:6737 EMAGE:6737 EMAGE:6737 EMAGE:6737
euxassay_007373_05 euxassay_007373_06 euxassay_007373_07 euxassay_007373_08 euxassay_007373_09
EMAGE:6737 EMAGE:6737 EMAGE:6737 EMAGE:6737 EMAGE:6737
euxassay_007373_10 euxassay_007373_11 euxassay_007373_12 euxassay_007373_13 euxassay_007373_14
EMAGE:6737 EMAGE:6737 EMAGE:6737 EMAGE:6737 EMAGE:6737
euxassay_007373_15 euxassay_007373_16 euxassay_007373_17 euxassay_007373_18 euxassay_007373_19
EMAGE:6737 EMAGE:6737 EMAGE:6737 EMAGE:6737 EMAGE:6737
euxassay_007373_20 euxassay_007373_21 euxassay_007373_22 euxassay_007373_23 euxassay_007373_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:6737Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
6737_wholemount_strong.wlz
6737_wholemount_moderate.wlz
6737_wholemount_weak.wlz
6737_wholemount_possible.wlz
6737_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6737_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 09 20 21 22 23 24
mesenchyme
moderate moderate
regionalmoderate expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24
submandibular gland primordium mesenchyme
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 18 19 20 21 22
neural retina
strong strong
regionalstrong expression: see section 04 moderate expression: see section 02 03 24
heart valve
strong strong
regionalstrong expression: see section 12 moderate expression: see section 13 15
esophagus
strong strong
regionalstrong expression: see section 13 14 15
mandible
strong strong
regionalstrong expression: see section 05 06 07 08 09 10 11 19 20 21 22 23 24 moderate expression: see section 12 13 14 16 17 18
maxilla
strong strong
regionalstrong expression: see section 06 07 08 09 10 11 19 20 21 22 23 moderate expression: see section 12 13 16 17 18
bladder
strong strong
regionalstrong expression: see section 14 15 16 17
temporal bone petrous part
moderate moderate
regionalmoderate expression: see section 02
vault of skull
moderate moderate
regionalmoderate expression: see section 01 02 03
orbito-sphenoid
strong strong
regionalstrong expression: see section 03 04 05 06 22 23 24 moderate expression: see section 01 02
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T3333
Entity Detected:Gpr153, G protein-coupled receptor 153 ( MGI:1916157)
Sequence:sense strand is shown

>T3333
TGGCCTCGAGCCAGATTCGGACGAGGCAAAATTCCACCATATTGCCTGTCTCCCACTATGTCGGCCGCTT
CCGTGGTCCTGCTGTGAAGGCTGCTGGTGCCTATCGCAGAGAACCAAAGCTCGTGGAAGTGGACTTTCGT
GTCTCAGTGCCCATCTCCAGTTTTGCCTCCCACAGGCAAAGTCCTTGGAAAGGGTGTCCTGTACCCCACT
TCCCCTGCAAGAAGGGCTTTGCTCTCTCCTGGGTCTGGGCTGTGCCAGGGACATGGGTATTCCCAGGAGA
GTCTGGGAGCTGGGAGCAGAGGGGGAGAGCTGTCACCAGACAGCGGACCCTCTGTGTTGGGACCTGGAGA
TAGTCTTAAGGCCAGCACAGAACCAGCCTGTGTCTCCTTGTTCTTGAGACGTGGTGGACAGGCCTGTCTC
CTCTCCCTCTGCAGACAGATTTCCAACCACAGCTGGGGATGAGGGAGGAGGGCTGGCCTACCCTAGGCCT
CAGAGGTCTCTGTTATCCCTGGTTAAGTAAAAGATCAGCCACCACAGAAGAGTAGAGCAGGG
Notes:The probe template was PCR amplified from IMAGE:314745 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:314745 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:6740 same embryo
 EMAGE:6738 same embryo
 EMAGE:6739 same embryo
 EurExpress:euxassay_007373 same experiment
 MGI:4825177 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS