Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:7980

Fry furry homolog (Drosophila) ( MGI:2443895)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:7980 EMAGE:7980 EMAGE:7980 EMAGE:7980 EMAGE:7980
"Pseudo-wholemount" of euxassay_016041. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016041_01 euxassay_016041_02 euxassay_016041_03 euxassay_016041_04
EMAGE:7980 EMAGE:7980 EMAGE:7980 EMAGE:7980 EMAGE:7980
euxassay_016041_05 euxassay_016041_06 euxassay_016041_07 euxassay_016041_08 euxassay_016041_09
EMAGE:7980 EMAGE:7980 EMAGE:7980 EMAGE:7980 EMAGE:7980
euxassay_016041_10 euxassay_016041_11 euxassay_016041_12 euxassay_016041_13 euxassay_016041_14
EMAGE:7980 EMAGE:7980 EMAGE:7980 EMAGE:7980 EMAGE:7980
euxassay_016041_15 euxassay_016041_16 euxassay_016041_17 euxassay_016041_18 euxassay_016041_19
EMAGE:7980 EMAGE:7980 EMAGE:7980 EMAGE:7980 EMAGE:7980
euxassay_016041_20 euxassay_016041_21 euxassay_016041_22 euxassay_016041_23 euxassay_016041_24

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:7980Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
7980_wholemount_strong.wlz
7980_wholemount_moderate.wlz
7980_wholemount_weak.wlz
7980_wholemount_possible.wlz
7980_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:7980_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
weak weak
regionalweak expression: see section 07 08 09 11 14 15 16
hindlimb digit 1 metatarsal
weak weak
regionalweak expression: see section 03 24
hindlimb digit 1 phalanx
weak weak
regionalweak expression: see section 24
hindlimb digit 2 metatarsal
weak weak
regionalweak expression: see section 03
hindlimb digit 2 phalanx
weak weak
regionalweak expression: see section 03 24
hindlimb digit 3 metatarsal
weak weak
regionalweak expression: see section 24
hindlimb digit 3 phalanx
weak weak
regionalweak expression: see section 03 24
hindlimb digit 4 metatarsal
weak weak
regionalweak expression: see section 04
hindlimb digit 4 phalanx
weak weak
regionalweak expression: see section 04 24
hindlimb digit 5 phalanx
weak weak
regionalweak expression: see section 24
fibula
weak weak
regionalweak expression: see section 02
tibia
weak weak
regionalweak expression: see section 02
upper leg rest of mesenchyme
weak weak
regionalweak expression: see section 01
vibrissa
weak weak
regionalweak expression: see section 05 06 07 22
diencephalon lateral wall mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
cerebral cortex mantle layer
strong strong
regionalstrong expression: see section 21 22 23 24
telencephalon mantle layer
strong strong
regionalstrong expression: see section 02 03 04 moderate expression: see section 01 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20 21 22 23
olfactory cortex mantle layer
moderate moderate
regionalmoderate expression: see section 10 11 12 14 15 16 17
medulla oblongata alar plate mantle layer
moderate moderate
regionalmoderate expression: see section 06 07 08 09 10 11 12 13 14 15 16 17
medulla oblongata basal plate mantle layer
moderate moderate
regionalmoderate expression: see section 07 08 09 10 11 12 13 14 15 16 17
rest of cerebellum mantle layer
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 20
pons mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
midbrain mantle layer
moderate moderate
regionalmoderate expression: see section 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
facial vii ganglion
strong strong
regionalstrong expression: see section 04 05 19 21
glossopharyngeal ix ganglion
strong strong
regionalstrong expression: see section 06 17 18
trigeminal v ganglion
strong strong
regionalstrong expression: see section 03 04 05 06 07 08 16 17 18 19 20 21 22
vagus x ganglion
strong strong
regionalstrong expression: see section 07
vestibulocochlear viii ganglion
strong strong
regionalstrong expression: see section 06 weak expression: see section 18
spinal cord mantle layer
moderate moderate
regionalmoderate expression: see section 09 10 11 13 14 15 weak expression: see section 08 12
cervico-thoracic ganglion
weak weak
regionalweak expression: see section 09 15
cervical ganglion
weak weak
regionalweak expression: see section 08 16
thoracic ganglion
weak weak
regionalweak expression: see section 13
dorsal root ganglion
strong strong
regionalstrong expression: see section 08 09 10 11 12 15 16 17
otic capsule
weak weak
regionalweak expression: see section 06 07 08 09 15 16 17 18
neural retina
weak weak
regionalweak expression: see section 01 02 03 22 23 24
nasal septum
weak weak
regionalweak expression: see section 12 13 14 15
cricoid cartilage
weak weak
regionalweak expression: see section 11 13
thyroid cartilage
weak weak
regionalweak expression: see section 10 11 12 13
axial skeleton
weak weak
regionalweak expression: see section 12 13
exoccipital bone
weak weak
regionalweak expression: see section 01 02 03 04 19 20 24
temporal bone
weak weak
regionalweak expression: see section 01 02 03 04 05 17 18 19 20 21 22 23
orbito-sphenoid
weak weak
regionalweak expression: see section 01 05 07 08 17 18 19 20 23 24
viscerocranium
weak weak
regionalExpression in the turbinate bone.
clavicle
moderate moderate
regionalmoderate expression: see section 09 15 16
sternum
moderate moderate
regionalmoderate expression: see section 12 13
pelvic girdle skeleton
moderate moderate
regionalmoderate expression: see section 09 18
axial skeleton tail region
weak weak
regionalweak expression: see section 13 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39694
Entity Detected:Fry, furry homolog (Drosophila) ( MGI:2443895)
Sequence:sense strand is shown

>T39694
ATGCAGAGACTCTCCTTTCCTGTGGGCTCCTGGACAAGCTCAAGTTCAGTGTGCTGGAACTGCAAGAATA
TCTGGACACGTACAACAACAGGAAAGAGGCCACACTCTCGTGGCTTGCCAACTGTAAGGCAACGTTTGCA
GGTGGCTCGAGAGATGGAGTGATTACCTGCCAACCCGGGGACTCGGAAGAAAAGCAAATGGAATCTCTTG
CACAACTGGAGCTGTGTCAGAGGCTGTACAAGCTGCATTTCCAGCTGCTCCTGCTCTATCAATCCTATTG
CAAGCTCATCGGCCAGGTGCATGAAGTGAGCTCCGTGCCCGAGCTGCTGAACATGTCCAGAGAACTGAGT
GATCTGAAGAGGAACCTGAAAGAGGCCACTGCCGCCATCGCCACAGACCCACTGTACATCGAGGGGGCGT
GGTCAGAACCAACCTTCACCTCCACAGAGGCGGCCATCCAGTCCATGCTGGAGTGCCTGAAGAACAATGA
ACTTGGCAAAGCCCTGAGGCAGATCAAAGAGTGCAGAAGCCTGTGGCCCAACGACATCTTTGGAAGCAGT
TCTGACGATGAGGTCCAGACACTCCTGAATATTTATTTCCGTCACCAGACTCTGGGACAGACGGGTACTT
ATGCCCTGGT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 103702. Forward Primer - name:103702_F_cDNA_9330186A19Rik, sequence:ATGCAGAGACTCTCCTTTCCTG; Reverse Primer - name:103702_N_SP6_cDNA_9330186A19Rik, sequence:ACCAGGGCATAAGTACCCGTC. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:7982 same embryo
 EMAGE:7977 same embryo
 EMAGE:7979 same embryo
 EMAGE:7978 same embryo
 EMAGE:7981 same embryo
 EurExpress:euxassay_016041 same experiment
 MGI:4824931 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS