Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8024

Usp32 ubiquitin specific peptidase 32 ( MGI:2144475)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8024 EMAGE:8024 EMAGE:8024 EMAGE:8024 EMAGE:8024
"Pseudo-wholemount" of euxassay_016000. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_016000_01 euxassay_016000_02 euxassay_016000_03 euxassay_016000_04
EMAGE:8024 EMAGE:8024 EMAGE:8024 EMAGE:8024 EMAGE:8024
euxassay_016000_05 euxassay_016000_06 euxassay_016000_07 euxassay_016000_08 euxassay_016000_09
EMAGE:8024 EMAGE:8024 EMAGE:8024 EMAGE:8024 EMAGE:8024
euxassay_016000_10 euxassay_016000_11 euxassay_016000_12 euxassay_016000_13 euxassay_016000_14
EMAGE:8024 EMAGE:8024 EMAGE:8024 EMAGE:8024 EMAGE:8024
euxassay_016000_15 euxassay_016000_16 euxassay_016000_17 euxassay_016000_18 euxassay_016000_19
EMAGE:8024 EMAGE:8024 EMAGE:8024 EMAGE:8024 EMAGE:8024
euxassay_016000_20 euxassay_016000_21 euxassay_016000_22 euxassay_016000_23 euxassay_016000_24
EMAGE:8024 EMAGE:8024
euxassay_016000_25 euxassay_016000_26

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8024Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8024_wholemount_strong.wlz
8024_wholemount_moderate.wlz
8024_wholemount_weak.wlz
8024_wholemount_possible.wlz
8024_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8024_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
lateral ventricle choroid plexus
weak weak
regionalweak expression: see section 07 08 09 10 11 12 16 17 18 19 20
metencephalon part of 4th ventricle choroid plexus
weak weak
regionalweak expression: see section 04 05 06 07 08 10 11 12 14 15 16 17 20 21
facial vii ganglion
weak weak
regionalweak expression: see section 05 06 21 22
glossopharyngeal ix ganglion
weak weak
regionalweak expression: see section 07 08 19
trigeminal v ganglion
weak weak
regionalweak expression: see section 04 05 06 07 08 09 18 19 20 21 22 23
vagus x ganglion
weak weak
regionalweak expression: see section 09 18
vestibulocochlear viii ganglion
weak weak
regionalweak expression: see section 08
dorsal root ganglion
weak weak
regionalweak expression: see section 08 09 10 11 12 13 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T39568
Entity Detected:Usp32, ubiquitin specific peptidase 32 ( MGI:2144475)
Sequence:sense strand is shown

>T39568
TGCTACCTCCTTTTTCCTGAAGTTTCATTCCGTTGTGTTACAAATGGAGAAAGCAAAACCATGCAGGAAT
GCAGATAGTTCTTATGGAATGGACACAAAGAGTTTTCAGTTTTTTGAATCATTTCCCCTATCTCTCTGTG
TCTTTCTTGCTTTTTGTTCTTGTTGGTTTTGTGTTTGAAACAGTGATTGGTGGCAGAGGCATATGACGGT
CAGTCTGAACCGAAGAGTCTCTGAAGACTATGTGCCTTCTACCCACACTCAGTTCTGAGAACCAGGAGAA
AGGAAAGGCAGCCATGGTGTCCAGCTCAGATGGCCCTCCTGTAGAGGCGCACTGCTGGGTGTGGCAGCTG
CCACAGGGTTTGCACCATAGGTCCCAAGCTGATGTTGCACACAGCTTCTAGGAAGGTAGGCGGCTGCGAA
GCCAGACTGTTTCCTGTTAGTGGTGGGATTGTTTTCCCCTTTGTTTCTCGTTTTGCACTTTAAAAGAGAG
AACACATGCAAACAACTGTGCTTGTACTTTAATGGCTCTAAGGGC
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 87611. Forward Primer - name:087611_F_cDNA_Usp32, sequence:TGCTACCTCCTTTTTCCTGAAG; Reverse Primer - name:087611_N_SP6_cDNA_Usp32, sequence:GCCCTTAGAGCCATTAAAGTACA. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8027 same embryo
 EMAGE:8028 same embryo
 EMAGE:8026 same embryo
 EMAGE:8025 same embryo
 EMAGE:8029 same embryo
 EurExpress:euxassay_016000 same experiment
 MGI:4829136 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS