Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8468

Herc3 hect domain and RLD 3 ( MGI:1921248)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8468 EMAGE:8468 EMAGE:8468 EMAGE:8468 EMAGE:8468
"Pseudo-wholemount" of euxassay_007296. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007296_01 euxassay_007296_02 euxassay_007296_03 euxassay_007296_04
EMAGE:8468 EMAGE:8468 EMAGE:8468 EMAGE:8468 EMAGE:8468
euxassay_007296_05 euxassay_007296_06 euxassay_007296_07 euxassay_007296_08 euxassay_007296_09
EMAGE:8468 EMAGE:8468 EMAGE:8468 EMAGE:8468 EMAGE:8468
euxassay_007296_10 euxassay_007296_11 euxassay_007296_12 euxassay_007296_13 euxassay_007296_14
EMAGE:8468 EMAGE:8468 EMAGE:8468 EMAGE:8468 EMAGE:8468
euxassay_007296_15 euxassay_007296_16 euxassay_007296_17 euxassay_007296_18 euxassay_007296_19
EMAGE:8468
euxassay_007296_20

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8468Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8468_wholemount_strong.wlz
8468_wholemount_moderate.wlz
8468_wholemount_weak.wlz
8468_wholemount_possible.wlz
8468_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8468_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
mesenchyme
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16
brain
moderate moderate
regionalmoderate expression: see section 03 04 05 06 07 08 10 11 12 13 14 15 weak expression: see section 01 02 09 16 17 18 19 20
pituitary gland
strong strong
spottedstrong expression: see section 08 09 10 11 12 13
spinal cord
moderate moderate
regionalmoderate expression: see section 10 11 12 13 14 15 weak expression: see section 09
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 15 weak expression: see section 09 14
otic capsule
strong strong
spottedstrong expression: see section 05 06 07 14 15 16
pharyngo-tympanic tube
strong strong
spottedstrong expression: see section 01 02 moderate expression: see section 20
esophagus
moderate moderate
regionalmoderate expression: see section 11
meckel's cartilage
moderate moderate
regionalmoderate expression: see section 02 03 05 06 07 08 09 10 11 12 13 14 15 16 weak expression: see section 04 17
left lung
moderate moderate
regionalmoderate expression: see section 02 03 04 05 06 07 08 09 10
right lung
moderate moderate
regionalmoderate expression: see section 11 12 13 14 15 16 17 18 19 20
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1889
Entity Detected:Herc3, hect domain and RLD 3 ( MGI:1921248)
Sequence:sense strand is shown

>T1889
CCCCTCTCCTCCCTTCCTCTTGCTCTCCTACTCTTCCTTGTCTTTGCTGCTTGACTCCGTTCCCCTCTTC
CTTCTGGTAGTGGATGCATGCTGTCTTTTTTATTTTAAATTTTGTAAGTTTTTTTTTAAACCTCTGTCTC
TAACTGTGAAAATATGAAGATACTCTTTATAATAGAGTTTTTGTTTTATCACATGTGAAGTGTGCATTTA
CAGTGAAATTTCAGCAGGGGGATTATGTTAAGTCAAATGCGTGTGTCTCAAAAGTGACATGTTTAACTGC
TCATCACTGTATAAGAAAATTCTACATGGTCAAAGAGTTCATGTAATTCTAATTTTAAATCTGTAGTAGA
TAGAGAAAGTATTTATTTATCTAAAATGAAGTACTTATAGATTGTGATGCAGCACCGAGTCTTGATGAAG
GAATGTAGATTTTTGCTTTTCCTGTTTTTGTTTTGAAAAGTTACTCCAATTGCTAAATTGGTAGTTTTTT
TGTCCTTATAAATATAACATTTAAAAAAGA
Notes:The probe template was PCR amplified from IMAGE:597752 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:597752 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8471 same embryo
 EMAGE:8467 same embryo
 EMAGE:8472 same embryo
 EMAGE:8469 same embryo
 EMAGE:8470 same embryo
 EurExpress:euxassay_007296 same experiment
 MGI:4825357 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS