Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8551

Nup43 nucleoporin 43 ( MGI:1917162)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8551 EMAGE:8551 EMAGE:8551 EMAGE:8551 EMAGE:8551
"Pseudo-wholemount" of euxassay_007275. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007275_01 euxassay_007275_02 euxassay_007275_03 euxassay_007275_04
EMAGE:8551 EMAGE:8551 EMAGE:8551 EMAGE:8551 EMAGE:8551
euxassay_007275_05 euxassay_007275_06 euxassay_007275_07 euxassay_007275_08 euxassay_007275_09
EMAGE:8551 EMAGE:8551 EMAGE:8551 EMAGE:8551 EMAGE:8551
euxassay_007275_10 euxassay_007275_11 euxassay_007275_12 euxassay_007275_13 euxassay_007275_14
EMAGE:8551 EMAGE:8551 EMAGE:8551 EMAGE:8551 EMAGE:8551
euxassay_007275_15 euxassay_007275_16 euxassay_007275_17 euxassay_007275_18 euxassay_007275_19
EMAGE:8551 EMAGE:8551
euxassay_007275_20 euxassay_007275_21

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8551Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8551_wholemount_strong.wlz
8551_wholemount_moderate.wlz
8551_wholemount_weak.wlz
8551_wholemount_possible.wlz
8551_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8551_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
mesenchyme
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 08 09 10 13 14 15 16 17 18 19 moderate expression: see section 07 11 12
pectoral girdle and thoracic body wall musculature
moderate moderate
regionalmoderate expression: see section 04 05 06 07
thymus primordium
weak weak
regionalweak expression: see section 12 13 14 15
nasal cavity olfactory epithelium
strong strong
spottedstrong expression: see section 09 10 16 17
midgut
weak weak
regionalweak expression: see section 07 08 09 10 11 12 13 14 15 16 17 18
lower jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 15
lower jaw molar
moderate moderate
regionalmoderate expression: see section 10 18
upper jaw incisor
moderate moderate
regionalmoderate expression: see section 11 12 15
upper jaw molar
moderate moderate
regionalmoderate expression: see section 10 18
liver
strong strong
spottedstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19
bladder
weak weak
regionalweak expression: see section 13 14
renal cortex
strong strong
spottedstrong expression: see section 08 09 10 11 17 18 moderate expression: see section 12 19
left lung
strong strong
spottedstrong expression: see section 03 04 05 06 07 09 10 11 12 moderate expression: see section 08
right lung
strong strong
spottedstrong expression: see section 13 14 15 16 17 18 19
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1827
Entity Detected:Nup43, nucleoporin 43 ( MGI:1917162)
Sequence:sense strand is shown

>T1827
GGCATGGAGGAAATTTATGCTAAGTTCGTGTCTCAGAAAATTAGCAAAACCCGCTGGCGGCCAGTGCCTT
CCGGGAGCCTGCAGACCACAGAGACCTTTGCCACGGGCTCTTGGGACAATGAGGAAAATTGCGTTTCACT
GTGGTCTATTGGAGATTTTGGAAACTTGGATTCTGACGGAGGGTTTGAAGGAGACCATCAGTTACTGTGC
GATATTAGACATCATGGGGATGTCATGGATTTACAGTTTTTTGACCAGGAAAGAATTGTAGCTGCTTCGT
CAACAGGCTGTGTAACAGTTTTTCTTCACCATCCAAATAACCAGACCCTGTCCGTCAATCAGCAGTGGCC
TGCAGCTCATTACCATACAGGTCCCAGCAGTCCCTCCTATAGCAGTGCACCATGTACAGGAATTGTGTGT
GACAACCCAGAAATTGTTACAGTTGGAGAGGATGGCCGAATAAATCTCTTCAGAGTTGATCACAAGGAGG
CTGTCAGAACTATAGATAATGCAGACAGCAGTACACTC
Notes:The probe template was PCR amplified from IMAGE:577944 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:577944 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8553 same embryo
 EMAGE:8552 same embryo
 EurExpress:euxassay_007275 same experiment
 MGI:4826834 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS