Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8552

Eme1 essential meiotic endonuclease 1 homolog 1 (S. pombe) ( MGI:3576783)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8552 EMAGE:8552 EMAGE:8552 EMAGE:8552 EMAGE:8552
"Pseudo-wholemount" of euxassay_007255. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_007255_01 euxassay_007255_02 euxassay_007255_03 euxassay_007255_04
EMAGE:8552 EMAGE:8552 EMAGE:8552 EMAGE:8552 EMAGE:8552
euxassay_007255_05 euxassay_007255_06 euxassay_007255_07 euxassay_007255_08 euxassay_007255_09
EMAGE:8552 EMAGE:8552 EMAGE:8552 EMAGE:8552 EMAGE:8552
euxassay_007255_10 euxassay_007255_11 euxassay_007255_12 euxassay_007255_13 euxassay_007255_14
EMAGE:8552 EMAGE:8552 EMAGE:8552 EMAGE:8552 EMAGE:8552
euxassay_007255_15 euxassay_007255_16 euxassay_007255_17 euxassay_007255_18 euxassay_007255_19
EMAGE:8552 EMAGE:8552 EMAGE:8552 EMAGE:8552
euxassay_007255_20 euxassay_007255_21 euxassay_007255_22 euxassay_007255_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8552Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8552_wholemount_strong.wlz
8552_wholemount_moderate.wlz
8552_wholemount_weak.wlz
8552_wholemount_possible.wlz
8552_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8552_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: two stars
Text Annotation:
StructureLevelPatternNotes
rib
strong strong
regionalstrong expression: see section 01 02 03 04 12 13 15 16 moderate expression: see section 11 weak expression: see section 07 08 09 10 17 18 19
hindlimb digit 1 metatarsal
strong strong
regionalstrong expression: see section 03
hindlimb digit 1 phalanx
strong strong
regionalstrong expression: see section 03 19
hindlimb digit 2 metatarsal
strong strong
regionalstrong expression: see section 03
hindlimb digit 2 phalanx
strong strong
regionalstrong expression: see section 03 04 18 19
hindlimb digit 3 metatarsal
strong strong
regionalstrong expression: see section 03
hindlimb digit 3 phalanx
strong strong
regionalstrong expression: see section 04 05 18 19
hindlimb digit 4 phalanx
strong strong
regionalstrong expression: see section 05 18 19
hindlimb digit 5 phalanx
strong strong
regionalstrong expression: see section 05 18 19
tarsus
strong strong
regionalstrong expression: see section 03 04
femur
moderate moderate
regionalmoderate expression: see section 08 10 18 19
otic capsule
strong strong
regionalstrong expression: see section 07 08 09 10
nasal septum
strong strong
regionalstrong expression: see section 11 12 13 14 15 16
cricoid cartilage
strong strong
regionalstrong expression: see section 13 15
thyroid cartilage
strong strong
regionalstrong expression: see section 12 13 14 15 16
trachea
strong strong
regionalstrong expression: see section 14 15 moderate expression: see section 16
axial skeleton
moderate moderate
regionalmoderate expression: see section 09 10 11 12 13 14 15 16 17 18
basisphenoid bone
strong strong
regionalstrong expression: see section 01 02 03 09 10 18 19
exoccipital bone
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 17 18 19 23
temporal bone petrous part
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 23
orbito-sphenoid
strong strong
regionalstrong expression: see section 01 02 03 04 05 06 07 08 09 12 14 15 18 19
viscerocranium
strong strong
regionalExpression in the turbinate bone.
sternum
strong strong
regionalstrong expression: see section 13 14
axial skeleton tail region
moderate moderate
regionalmoderate expression: see section 15 16 17
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T1826
Entity Detected:Eme1, essential meiotic endonuclease 1 homolog 1 (S. pombe) ( MGI:3576783)
Sequence:sense strand is shown

>T1826
TGGCCTCGAGNCAGATTCGGCACGAGGGCAGTAGCAGGATGGAGATGACTGGATGGAAGAGCCAACAATC
CTGGTGTTGGTCCTGGCAGAGGTCTTCATGTCCATGGCCTACAACTTAAAGCAGGCAAGTCCTAGCAGCA
CCGAGAAAGGGAAGGAGACCCTTCGGAGCTTTGTAACTGATGTCACAGCAAAGACGGGGAAAGCATTGTC
ACTGGTGATTGTGGACCAGGAGAAATGCTTCAGGCCTCAGAATCCCCCGAGGAGAAGGAAATCAGGAATG
GCAAATAAACAGGCCAAAGCGAAGCATCAGCAGAGGCAAGAGTCTAGCACGGGACTCATGGTGTCCAGGG
CAGACATGGAGAAGGCACTGGTGGATCTGCAGCTTTATACAGAAGCCCAGGCGTGGATGGTGCAGAGCTG
GAAGGAGCTGGCGGACTTCACCTGTGCATTTACAAAGGCTGTGGCTGAAGCACCCTTCAAGAAGCTCCGG
GATCAAGTCACCTTTTCCTTCTTCCTGGAGAAAGACTGGGCTGGAGGGATGAAAGTGGACCAGT
Notes:The probe template was PCR amplified from IMAGE:577771 using vector specific primers. Forward Primer - name:RZPD M13 forward, sequence:GCTATTACGCCAGCTGGCGAAAGGGGGATGTG; Reverse Primer - name:RZPD M13 reverse, sequence:CCCCAGGCTTTACACTTTATGCTTCCGGCTCG. Anti-sense probe was then transcribed from the PCR amplified template using T3 polymerase. EMAGE Editor's Note: the partial probe sequence indicated here was given by the EURExpress Consortium and has been checked using BLAST comparison against all available partial insert sequences of IMAGE:577771 from NCBI. In cases where no BLAST hit was found (because the two sequence reads are found at opposing ends of the insert sequence), both end sequences were then checked against the appropriate cDNA RefSeq to ensure validity of the information.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8553 same embryo
 EMAGE:8551 same embryo
 EurExpress:euxassay_007255 same experiment
 MGI:4824540 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS