Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:8962

Kif21a kinesin family member 21A ( MGI:109188)
TS23 (14.5 dpc)
in situ hybridisation

Data Images
EMAGE:8962 EMAGE:8962 EMAGE:8962 EMAGE:8962 EMAGE:8962
"Pseudo-wholemount" of euxassay_012905. This image has been made by aligning and collapsing the constitutent sections. Information about the method. euxassay_012905_01 euxassay_012905_02 euxassay_012905_03 euxassay_012905_04
EMAGE:8962 EMAGE:8962 EMAGE:8962 EMAGE:8962 EMAGE:8962
euxassay_012905_05 euxassay_012905_06 euxassay_012905_07 euxassay_012905_08 euxassay_012905_09
EMAGE:8962 EMAGE:8962 EMAGE:8962 EMAGE:8962 EMAGE:8962
euxassay_012905_10 euxassay_012905_11 euxassay_012905_12 euxassay_012905_13 euxassay_012905_14
EMAGE:8962 EMAGE:8962 EMAGE:8962 EMAGE:8962 EMAGE:8962
euxassay_012905_15 euxassay_012905_16 euxassay_012905_17 euxassay_012905_18 euxassay_012905_19
EMAGE:8962 EMAGE:8962 EMAGE:8962 EMAGE:8962
euxassay_012905_20 euxassay_012905_21 euxassay_012905_22 euxassay_012905_23

View assay images: EMAGE genex expression entry
Expression pattern clarity: no stars
Find spatially similar wholemount expression patterns: Find spatially similar wholemount patterns
Expression Pattern Description
Spatial Annotation:
EMAGE:8962Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
wholemount mapping

Download individual expression domains:
8962_wholemount_strong.wlz
8962_wholemount_moderate.wlz
8962_wholemount_weak.wlz
8962_wholemount_possible.wlz
8962_wholemount_not_detected.wlz
(what is wlz format?)
Download all expression domains: EMAGE:8962_all_domains.zip
Find spatially similar wholemount expression patterns:  EMAGE spatially similar wholemount patterns
Morphological match to the template: one star
Text Annotation:
StructureLevelPatternNotes
diencephalon lateral wall ventricular layer
moderate moderate
regionalmoderate expression: see section 10 11 12 weak expression: see section 13
telencephalon ventricular layer
moderate moderate
regionalmoderate expression: see section 12 16 17 18 weak expression: see section 01 02 03 04 05 06 07 08 09 10 13 14 15 19 20 21 22
medulla oblongata basal plate mantle layer
weak weak
regionalweak expression: see section 08 09 15
cerebellum intraventricular portion mantle layer
weak weak
regionalweak expression: see section 06 08
pons mantle layer
weak weak
regionalweak expression: see section 16 17
pons ventricular layer
weak weak
regionalweak expression: see section 16 17
midbrain ventricular layer
moderate moderate
regionalmoderate expression: see section 12 16 17 weak expression: see section 07 08 09 10 13 14 15
facial vii ganglion
moderate moderate
regionalmoderate expression: see section 04 18 19 20 weak expression: see section 03
glossopharyngeal ix ganglion
moderate moderate
regionalmoderate expression: see section 06 17
trigeminal v ganglion
moderate moderate
regionalmoderate expression: see section 04 05 06 07 15 16 17 18 19 20 21 weak expression: see section 02 03
vagus x ganglion
moderate moderate
regionalmoderate expression: see section 06 07 16
trigeminal v nerve
moderate moderate
regionalmoderate expression: see section 15
spinal cord mantle layer
weak weak
regionalweak expression: see section 09 10
dorsal root ganglion
moderate moderate
regionalmoderate expression: see section 06 07 08 09 16 17 weak expression: see section 14 15
Annotation Validation: spatial mapping by EMAGE editor, text annotation by author
Detection Reagent
Type:in situ hybridisation probe
Identifier:T38680
Entity Detected:Kif21a, kinesin family member 21A ( MGI:109188)
Sequence:sense strand is shown

>T38680
GGCCCATGTCTGATAAAGTAGCGGGAAAAGTTACTCGGAAGCTGAGCTCATCCGAAAGCCCCGCTCCGGA
CACAGGTTCCAGTGCGGCTTCCGGGGAAGCAGACACATCACGGCCAGGCACCCAGCAGAAAATGAGGATC
CCCGTGGCAAGAGTCCAGGCATTACCAACACCTACAACAAATGGCACCAGGAAAAAATATCAGAGGAAAG
GATTCACTGGCCGGGTGTTCACTTCCAAGACAGCCCGCATGAAGTGGCAGCTACTGGAGCGCCGGGTGAC
CGACATCATCATGCAGAAAATGACCATCTCCAACATGGAGGCGGACATGAACAGACTCCTCAGGCAACGG
GAAGAACTCACAAAAAGGCGAGAGAAACT
Notes:The probe template was received by the EURExpress consortium as an aliquot of PCR product from the Allen Brain Atlas (originally amplified from wild type C57BL/6J mouse whole brain cDNA), and this was re-amplified using the gene-specific Allen Brain Atlas Primer Pair 155382. Forward Primer - name:155382_F_cDNA_TC1570705, sequence:GGCCCATGTCTGATAAAGTAGC; Reverse Primer - name:155382_N_SP6_cDNA_TC1570705, sequence:AGTTTCTCTCGCCTTTTTGTG. The reverse primer contains a 5' extension containing an Sp6 RNA polymerase binding site (this extension is not shown in the primer sequence listed here). Anti-sense probe was transcribed from the PCR amplified template using Sp6 polymerase.
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:C57BL/6
Age:14.5 dpc
Theiler Stage:TS23
Mutations:none (wild-type)
Preparation:section
Procedures
Fixation:none
Embedding:cryosection (OCT)
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Dr. Graciana Diez-Roux, Prof. Gregor Eichele, Prof. Richard Baldock, Dr. Duncan Davidson, Prof. Stylianos Antonarakis, Dr. Marie Laure Yaspo, Prof. Salvador Martinez Perez, Dr. Pascal Dolle, Dr. David Tannahill, Prof. Pier Paolo Di Fiore, Mr. Stefan Kruse, Mr. Paolo Sarmientos, Dr. Uwe Radelof, Prof. Andrea Ballabio.
Principal investigator:Professor Andrea Ballabio, Fondazione Telethon, TIGEM Instituto di Genetica e Medicina, Via Pietro Castellino 111 80131, Napoli, Italy 80131
Submitted by:EMAGE EDITOR, Institute of Genetics and Molecular Medicine, Western General Hospital, Crewe Road, Edinburgh, UK EH4 2XU
Experiment type:screen
References:[ doi:10.1371/journal.pbio.1000582] [ PMID:21267068] Diez-Roux G, Banfi S, Sultan M, Geffers L, Anand S, Rozado D, et al 2011 A High-Resolution Anatomical Atlas of the Transcriptome in the Mouse Embryo PLoS Biol (9)
Links:EMAGE:8959 same embryo
 EMAGE:8958 same embryo
 EMAGE:8960 same embryo
 EMAGE:8961 same embryo
 EMAGE:8963 same embryo
 EurExpress:euxassay_012905 same experiment
 MGI:4825757 same experiment
  Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEUREXPRESS