Quicksearch Help

(Click the icon to keep this page displayed.)

EMAGE:6136

Wnt2b wingless related MMTV integration site 2b ( MGI:1261834)
TS17 (10.5 dpc)
in situ hybridisation

Data Images
EMAGE:6136 EMAGE:6136 EMAGE:6136 EMAGE:6136 EMAGE:6136
3D reconstructed object showing signal. All sections along the X-axis, as movie. All sections along the Y-axis, as movie. All sections along the Z-axis, as movie. Photograph prior to 3D imaging.

View 3D opt image: EMAGE genex expression entry
Download 3D images in woolz format
Expression pattern clarity: one star
Find spatially similar expression patterns: Find spatially similar patterns
Notes:
This is a traditionally produced wholemount in situ hybridisation stained using alkaline phosphatase + NBT/BCIP. It has been imaged using Optical Projection Tomography using visible light. In the OPT images, the signal is visible as the brightest regions.
Expression Pattern Description
Spatial Annotation:
EMAGE:6136Annotation colour key:  
strong strong      
gene expression moderate moderate    
gene expression weak weak        
gene expression possible possible    
gene expression not detected not detected
3D mapping

View mapped 3D expression image EMAGE genex expression entry
Download individual expression domains:
6136_voxel_possible_3D_1.wlz
(what is wlz format?)
Download all expression domains: EMAGE:6136_all_domains.zip
Find spatially similar expression patterns: EMAGE spatially similar patterns
Morphological match to the template: no stars
Text Annotation:
StructureLevelPatternNotes
embryo
detected detected
Annotation Validation: Submitter + EMAGE Editor
Detection Reagent
Type:in situ hybridisation probe
Identifier:Wnt2b probeA
Entity Detected:Wnt2b, wingless related MMTV integration site 2b ( MGI:1261834)
Sequence:sense strand is shown

>Wnt2b probeA
GCACAGGTGACTACCTGAGGAGGCGATATGATGGGGCTGTGCAGGTGACGGCCACACAGGATGGGGCCAA
TTTCACAGCAGCGCGCCAGGGCTATCGCCACGCCACCCGGACTGATCTTGTCTACTTTGACAACTCCCCT
GACTACTGTGTCTTGGACAAGGCTGCAGGTTCCCTAGGTACCGCAGGCCGCGTCTGCAGCAAGACT
nt 1010 - nt 1215 of NM_009520.3
Notes:The template used to generate the Wnt2b probe used in this study was obtained from L.Zakin. Probe was transcribed from the entire insert. The insert sequence of the clone has been verified by Summerhurst and Murphy (it spans nt 1010-1215 of the Wnt2b cDNA RefSeq NM_009520.3).
Chemistry:RNA
Strand:antisense
Label:digoxigenin
Specimen
Organism:mouse
Strain:CD1
Age:10.5 dpc
Theiler Stage:TS17
Mutations:none (wild-type)
Preparation:opt
Procedures
Fixation:4% paraformaldehyde
Embedding:agarose
Staining procedure:alkaline phosphatase + NBT/BCIP
General Information
Authors:Kristen Summerhurst, Paula Murphy
Principal investigator:Paula Murphy, Trinity College Dublin, Zoology Department, Dublin, Ireland 2
Submitted by:Kristen Summerhurst, Trinity College Dublin, Zoology Department, Dublin, Ireland 2
Experiment type:non-screen
Links: Ensembl same gene
  Allen Brain Atlas same gene
  BioGPS same gene
  International Mouse Knockout Project Status same gene
  GEISHA Chicken ISH Database same gene
  EMBL-EBI Gene Expression Atlas same gene
  BrainStars same gene
  ViBrism same gene
Data SourceEMAGE